ID: 1138948983

View in Genome Browser
Species Human (GRCh38)
Location 16:61887572-61887594
Sequence CCTTACATGAAGAGGAAATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1082
Summary {0: 1, 1: 2, 2: 34, 3: 247, 4: 798}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138948983_1138948986 -1 Left 1138948983 16:61887572-61887594 CCGGATTTCCTCTTCATGTAAGG 0: 1
1: 2
2: 34
3: 247
4: 798
Right 1138948986 16:61887594-61887616 GACACCATTCAGACAGCATTAGG 0: 1
1: 0
2: 4
3: 50
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138948983 Original CRISPR CCTTACATGAAGAGGAAATC CGG (reversed) Intronic
900532082 1:3159481-3159503 CCTTGTATGAAGAGGAGATGAGG - Intronic
900901714 1:5521158-5521180 CCTTATAAGAAGAGGAGATTTGG - Intergenic
901145230 1:7060365-7060387 CCTCACAAGAAGAGGAGATGAGG - Intronic
901856096 1:12045054-12045076 CCTTACAAAAAGGGGAAATTTGG + Intergenic
902167617 1:14585021-14585043 CCTTACAAGAAGAGGAGATGAGG + Intergenic
902333071 1:15740209-15740231 CCTTATAAGAGGAGGAGATCAGG - Exonic
902404912 1:16177306-16177328 CCTTCCATGGAGAGGAATTCTGG + Intergenic
902999181 1:20252552-20252574 CCTTAAAAGAAGAGGAAATTTGG + Intergenic
903072976 1:20736978-20737000 CCTTATAGGAAGAGGAAATTTGG + Intergenic
903976925 1:27156215-27156237 CCTTATAAAAAGGGGAAATCTGG - Intronic
904203588 1:28837814-28837836 CCTTACATGAAGAGAGAGTTGGG - Intronic
905136795 1:35806754-35806776 CCTTATAAGAAGAGGAAATTTGG + Intergenic
905488548 1:38325448-38325470 CCTTCCAAGAAGAGGAGATGAGG - Intergenic
906225719 1:44119558-44119580 CGTTACATGAAGAAGAAGTCAGG + Intronic
906879482 1:49574988-49575010 CCTTGAATGAAGGGGAAGTCGGG + Intronic
907153740 1:52312977-52312999 CCTTATAAGAAGGGGAAATATGG + Intronic
907182670 1:52584527-52584549 GCTTATAAGAAGAGGAAATTTGG + Intergenic
907710733 1:56878154-56878176 TCTTACAGGAAGGGGAAATTAGG - Intronic
907717856 1:56944296-56944318 CCAAAAATGAAGAAGAAATCAGG - Intronic
908061320 1:60352772-60352794 CCTTATATGAAGAGGAAATTTGG + Intergenic
908769102 1:67580378-67580400 CCTTACAAGAAGAGGAAATGTGG - Intergenic
908886165 1:68791369-68791391 CCTTATAAGAAGAGGAGATGAGG + Intergenic
910112904 1:83701297-83701319 CCTTGTAAGAAGAGGAAATCTGG + Intergenic
910270840 1:85392295-85392317 CTTTATAAGAAGAGGAAATTTGG - Intronic
910286273 1:85557775-85557797 TCTTACAGGAAGAGGAAATTTGG + Intronic
910301377 1:85710436-85710458 CTTTATAAGAAGAGGAAATTTGG + Intergenic
910551565 1:88481329-88481351 CCTTATAAGAAGAGGAGATGAGG + Intergenic
910816370 1:91295470-91295492 TCTTATAAGAAGAGGAAATTAGG - Intronic
911506373 1:98757466-98757488 CCTTATAAGAAGAGGAAATCTGG - Intronic
911942966 1:104070622-104070644 GCTTAGATGCAGAGGAAAACTGG + Intergenic
913066180 1:115257531-115257553 CCTTGTAAGAAGAGGAAATTAGG - Intergenic
914315636 1:146508910-146508932 CCTTATAAGAAGAGGAAATTTGG - Intergenic
914433897 1:147643040-147643062 CCTTATAAGAAGAGGAAATGAGG - Exonic
914498719 1:148224451-148224473 CCTTATAAGAAGAGGAAATTTGG + Intergenic
914949973 1:152104703-152104725 CCTTATAAGAAGATGAAATTTGG - Intergenic
915605695 1:156948760-156948782 CCTAACAGGAAGATGAAATCTGG + Intronic
915661402 1:157408675-157408697 CCTTATAAAAAGAGGGAATCTGG - Intergenic
915719967 1:157977768-157977790 TCTTATAAGAAGAGGAAATTAGG + Intergenic
915921779 1:159981193-159981215 CCTTATAAGAAAAGGAAACCAGG + Intergenic
916002635 1:160631618-160631640 CCTTATAAGAAGAGGAAATCTGG + Intronic
916002671 1:160631929-160631951 CCTTATGAGAAGAGGAAATTTGG + Intronic
916655323 1:166870279-166870301 CCTTATAAGAAGAGGCAATTAGG + Intronic
916881474 1:169023382-169023404 CCTTATAAGAAGAGAAAATGTGG - Intergenic
916885102 1:169059825-169059847 CCTTATAAGAAGAGGAAATTTGG + Intergenic
917426584 1:174920717-174920739 CCTTGTAAGAAGAGGAAATTTGG + Intronic
917491855 1:175504877-175504899 CCTTAGAAGAAGAAGAAATTTGG + Intronic
917968254 1:180191994-180192016 CCTTGCAGGAAGAGGAAATTTGG - Intronic
918608279 1:186456032-186456054 CCTAACATGCAGAGGAATACTGG - Intronic
918706304 1:187667036-187667058 CCTTATAAGAAGAAGAAATTTGG - Intergenic
919760215 1:201093272-201093294 CCTTATAAGAAGAGGAACTCTGG + Intronic
919904132 1:202066260-202066282 CGTTACATGGAGAGTAACTCTGG + Intergenic
920282976 1:204858218-204858240 CCTTATAAGAAGAGGAGATTAGG - Intronic
920446926 1:206024710-206024732 CCTTATAAGAAGAGGAAATGTGG - Intergenic
920718127 1:208360517-208360539 CCTTGTAAGAAGAGGAAATTTGG + Intergenic
920755192 1:208723349-208723371 CCTTATGAGAAGAGGAAATTAGG + Intergenic
920869144 1:209779033-209779055 CCTTATAAGAAGGGGAAATATGG - Intronic
921017227 1:211203263-211203285 CCTTGTAGGAAGAGGAAATTTGG + Intergenic
921102000 1:211936580-211936602 CCTTCCATAAAGACAAAATCTGG + Intergenic
921411011 1:214836338-214836360 CCTTATAAGAAGGGGAGATCAGG + Intergenic
921510851 1:216027221-216027243 CCTTATAAGAAGAGAAAATTTGG + Intronic
921566690 1:216729999-216730021 CTTTACAGGTAAAGGAAATCAGG + Intronic
921721196 1:218473546-218473568 TCTTATGTGAAGAGGAAGTCAGG + Intergenic
922141334 1:222890896-222890918 CCTTATAAAAAGAGGAAATCTGG - Intronic
922587204 1:226743062-226743084 CCTTATAGGAAGAGGAGATTAGG - Intergenic
922767057 1:228161677-228161699 CCTTAAAAGAAGAGGAGATTAGG - Intergenic
922881646 1:228985650-228985672 CCTTATAAGAAGAGGAGATGAGG - Intergenic
922993774 1:229939866-229939888 TCTTTCAAGAAGAGGGAATCTGG + Intergenic
923064192 1:230503217-230503239 CCTTACAAGAAGAAGAGATTAGG + Intergenic
923492645 1:234498058-234498080 CCTTATAAGAAGAGAAAATTAGG + Intergenic
923656480 1:235921557-235921579 CCTTATAAAAAGAGGAAATTTGG + Intergenic
923768496 1:236915356-236915378 TCTTACAAGAAGAGGAGATTAGG + Intergenic
923889295 1:238194419-238194441 CCTCAAATGAGGAGGAAATGAGG - Intergenic
923972298 1:239218096-239218118 CCTTATAACAAGAGGAAATTAGG + Intergenic
924388167 1:243520211-243520233 CTTTACAAGAAGAGGAAATTTGG + Intronic
924576918 1:245289040-245289062 ACTTACATATAGAGGAAGTCGGG + Intronic
1062957675 10:1551119-1551141 CCTTATAAGAAGAGGAGATGAGG + Intronic
1063168062 10:3481754-3481776 CCTTAGAAGAAGAGGACATTTGG - Intergenic
1063255310 10:4320988-4321010 TCTTATAAGAAGAGGAGATCAGG - Intergenic
1064074788 10:12260055-12260077 TCTTATCAGAAGAGGAAATCTGG + Intergenic
1065228703 10:23574576-23574598 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1065811994 10:29450896-29450918 CTTTATATGAAGGGGAAATTGGG - Intergenic
1065856570 10:29835832-29835854 CCTTAGATGAAGAGAGAATAAGG + Intergenic
1065959787 10:30725261-30725283 CTTTATATGAAGGGGAAATTGGG + Intergenic
1066452679 10:35545507-35545529 CCTTACATAAAGGGGAAACTTGG - Intronic
1067203503 10:44194808-44194830 CCTTATAAGAAGAGGATATTAGG - Intergenic
1067244048 10:44521460-44521482 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1067408835 10:46047223-46047245 CCTTATCAGAAGAGGAAATTTGG - Intergenic
1067460209 10:46452607-46452629 CCTTATAAGAAGGGGAAATTTGG - Intergenic
1067518134 10:46972894-46972916 CCTTATATAAAGAAGAAATTGGG + Intronic
1067548421 10:47214415-47214437 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1067626981 10:47931996-47932018 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1067644115 10:48078934-48078956 CCTTATATAAAGAAGAAATTGGG - Intergenic
1067658796 10:48218146-48218168 CCTTATAAGAAGAAGAAATTTGG - Intronic
1068141255 10:53010421-53010443 GCTTCCATGCATAGGAAATCTGG + Intergenic
1069268772 10:66497007-66497029 CCTTGCAAGAAGAGGGAATTAGG - Intronic
1069305312 10:66962173-66962195 CCTTTCATGATGAGGAAATGGGG - Intronic
1069363747 10:67674229-67674251 CCTTCTAAGAAGAGGAAATTAGG + Intronic
1070489039 10:76958628-76958650 CCTTACAAGAAGAGGAAATTTGG + Intronic
1070548081 10:77468502-77468524 CCTTAGAAGAAGAGGAAATTAGG + Intronic
1070746804 10:78938598-78938620 CATTTCATGAAGAGGAAACGAGG - Intergenic
1071041860 10:81319209-81319231 CCATATATGAGGAGGAAATTTGG - Intergenic
1071196927 10:83172287-83172309 CCTTACAGAAAGAACAAATCTGG - Intergenic
1071415888 10:85441075-85441097 CCTTAGAGGAAGAGGAGATGAGG + Intergenic
1071765084 10:88655024-88655046 GCTTATAAGGAGAGGAAATCTGG + Intergenic
1072058018 10:91780056-91780078 CCATTCCTGAAGAAGAAATCTGG - Intergenic
1073545993 10:104349456-104349478 CCTTACAAGAAGAGGAAAATTGG - Intergenic
1073570326 10:104575880-104575902 CCTTATAAGAAGAGGATATTTGG + Intergenic
1074062907 10:109984180-109984202 CCTTACAAAAAGGGGAAATTTGG + Intergenic
1074578786 10:114696432-114696454 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1074868636 10:117560147-117560169 CCTTACAAGAAGAGGAAGTTTGG + Intergenic
1075218491 10:120561412-120561434 CCTTACATGAACATGAAATATGG - Intronic
1075263971 10:120985144-120985166 GCTTATAAGAAGAGGAAATTTGG - Intergenic
1075479792 10:122769984-122770006 ACTTCCATGAAGAGGAAAATAGG - Intergenic
1076000865 10:126912117-126912139 CCTTGTAAGAAGAGGAAATGAGG - Intronic
1076069483 10:127475431-127475453 CCTTACATGGTGAGGAACTGAGG + Intergenic
1076183119 10:128426111-128426133 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1076235796 10:128862986-128863008 CCTGAGGAGAAGAGGAAATCTGG + Intergenic
1076327507 10:129637723-129637745 CCTTATAAGAAGAGGAGATTAGG + Intronic
1077777830 11:5291321-5291343 CCTTACAGGGACAGGACATCTGG - Intronic
1077999486 11:7482184-7482206 CCTTATACAAAGAGGAAATTTGG - Intergenic
1078191478 11:9095159-9095181 AGCTATATGAAGAGGAAATCTGG + Intronic
1078320894 11:10333571-10333593 CCTTATAAGAAGAGGAGATTAGG + Intronic
1078361386 11:10670746-10670768 CCTTATAAGAAGAGGAAATTTGG + Intronic
1078864512 11:15284481-15284503 CCTTGTAAGAAGAGGAAATTTGG + Intergenic
1079072248 11:17357338-17357360 CCTTATAAGAAGAGGAAATTAGG - Intronic
1079202027 11:18384582-18384604 CCTGACCAGAAGAGGAAAGCAGG - Intergenic
1079293039 11:19205800-19205822 CCTTGTAAGAAGAGGAAATTAGG - Intronic
1079590299 11:22175359-22175381 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1079713530 11:23716796-23716818 CCATATAGGAAGAGGAAATATGG + Intergenic
1080051430 11:27862995-27863017 CCTTAGAAGAAGAGGCAATTAGG - Intergenic
1080151052 11:29052371-29052393 CCTCATATGAAGAGGAAAAATGG + Intergenic
1080580413 11:33637751-33637773 CCTTCTAAGAAGAGGAAATTTGG - Intronic
1081205494 11:40270398-40270420 CCTTTTAAGAAGAGGAAATCTGG - Intronic
1081578785 11:44337295-44337317 CTTTCCATGAAGAGGAAAACAGG + Intergenic
1082766628 11:57173737-57173759 CATTATATGAAAAGGAAATGGGG - Intergenic
1082781057 11:57287681-57287703 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1083025373 11:59546279-59546301 CCTTACAAAAAGGGGAAATTTGG + Intergenic
1084547888 11:69823468-69823490 CCTTATAAGAAGAGGTAATGAGG - Intergenic
1084724997 11:70935831-70935853 GCTCACATGACGAGGAACTCAGG - Intronic
1086184036 11:83991942-83991964 CCTTATAAGAAGAGGAAATTTGG + Intronic
1086252392 11:84832091-84832113 CCATACATGAAGAGGAATTCTGG + Intronic
1086573483 11:88311753-88311775 CCTTATAAGAAGAGGACATTAGG + Intronic
1086738680 11:90340071-90340093 ACTTATAAGAAGAGGAAATTTGG - Intergenic
1086852432 11:91825703-91825725 CCTTCTAAGAAGAGGAAATTTGG - Intergenic
1086858569 11:91897175-91897197 TCTTATAAGAAGAGGAAATTTGG - Intergenic
1086932074 11:92704576-92704598 CCTTATAAGAAGAGGAAATTTGG + Intronic
1087494493 11:98872642-98872664 CCTTACAAAAAGAGAAAATCTGG - Intergenic
1087608563 11:100406722-100406744 CCTTATAAGAAGAAGAAATGTGG + Intergenic
1088363073 11:109011436-109011458 CCTTATAAGAAGAAGAAATTTGG + Intergenic
1088433093 11:109779918-109779940 CCTTATAAGAAGAAGAAATTTGG + Intergenic
1088556931 11:111071265-111071287 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1088698376 11:112389805-112389827 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1088755559 11:112882411-112882433 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1088946549 11:114519011-114519033 TCTTATAAGAAAAGGAAATCTGG - Intergenic
1089013990 11:115152024-115152046 CCTTATAAGAAGAGGACATTTGG + Intergenic
1089308734 11:117543986-117544008 CCTTCCTTGCAGAGGAAATGGGG - Intronic
1089445156 11:118546111-118546133 CCTTATAGGAAGAAGAAATCAGG + Intronic
1089576742 11:119449765-119449787 CCTTATAAGAAGAGGAGATTTGG + Intergenic
1089936838 11:122373027-122373049 CATTAGTTGAAGAGGAAATCTGG - Intergenic
1090634412 11:128681697-128681719 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1091071585 11:132569256-132569278 CCTCATAAGAAGAGGAAATTAGG + Intronic
1091118332 11:133035774-133035796 CCTTATAAGAAGAGGACATTTGG + Intronic
1091177434 11:133574391-133574413 CCTTAACTGAAAAGGAAATGAGG + Intergenic
1091269829 11:134300268-134300290 CCTTATAAGAAGAGGAGATTAGG - Intronic
1091404649 12:201719-201741 CCACATATGAAGAGGAAATTTGG - Intronic
1093120359 12:15264027-15264049 CCTTATAAAAAGAGGAAATATGG + Intronic
1093540653 12:20280276-20280298 CCTTATATGAAGAGAAAATTTGG - Intergenic
1093830055 12:23744970-23744992 CTTTATAAGAAGAGGAAATTTGG - Intronic
1094080841 12:26533642-26533664 CCCTATAAGAAGAGGAAATTTGG + Intronic
1094450855 12:30581854-30581876 TCTTACAAGAAAAGGAAATTTGG + Intergenic
1094620145 12:32073084-32073106 CCTTATAAGAAAAGGAAATTTGG - Intergenic
1095283035 12:40379081-40379103 CCTTATAAGAAGAGAAAGTCTGG - Intergenic
1097206368 12:57324934-57324956 CATTATAAGAAGAGGAAATTTGG + Intronic
1097750588 12:63348074-63348096 CCTTACAAAAAGGGGAAATTTGG + Intergenic
1097914163 12:65002626-65002648 CCTTATAGGAAGAGGAGATTAGG + Intergenic
1098706382 12:73695774-73695796 CCTTACAAGAAAAGGAAATTTGG + Intergenic
1098815798 12:75160181-75160203 CCTTATAAGAAGAAGAAATTTGG + Intronic
1098938077 12:76503357-76503379 CCTTATAAGAAGAGGAAATTTGG - Intronic
1099030358 12:77519001-77519023 TCTTAAATAAATAGGAAATCAGG - Intergenic
1099230552 12:80019021-80019043 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1100015516 12:90005959-90005981 CCTTACAAGAAAAGAAAATTTGG + Intergenic
1100068293 12:90678703-90678725 CCTTATAAAAAGAGGAAATTTGG + Intergenic
1100365088 12:93912936-93912958 CCTTATAAGAAGAGGAAATGTGG + Intergenic
1100366614 12:93927083-93927105 CCTTATAACAAGAGGAAATTGGG + Intergenic
1100442741 12:94631430-94631452 CCTTATAAGAAGAGAAAATCTGG + Intronic
1100784758 12:98067013-98067035 CCTAATAGGAAGAGGAAATCAGG + Intergenic
1100857643 12:98772307-98772329 CCTTACAAGAAGAGGAAATTTGG + Intronic
1101003126 12:100376035-100376057 CCTTATATGAAGAAAAAATTGGG + Intronic
1101071642 12:101081863-101081885 CTTTATAAGAAGAGGAAATTTGG - Intronic
1101115280 12:101525530-101525552 CCTTATAAAAAGGGGAAATCTGG - Intergenic
1101214472 12:102566838-102566860 CCTTATAAGAAGAGAAAATTTGG - Intergenic
1101552378 12:105774688-105774710 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1101607248 12:106256998-106257020 CCTTATGAGAAGAGGAAATTTGG - Intronic
1101702242 12:107185017-107185039 CCTTACAGGAGGAGGATATTTGG + Intergenic
1101729725 12:107416934-107416956 CCTTGCATTAAGAGGACATGGGG - Intronic
1101750105 12:107576486-107576508 CCTTAGAAGAAGAGGAGATCAGG - Intronic
1101820208 12:108178260-108178282 CCTTACAAAAGGAGGAAATCAGG - Intronic
1102598387 12:114010796-114010818 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1102663042 12:114546273-114546295 CCTTACAAGAAGAGGAAATCTGG + Intergenic
1102665010 12:114564357-114564379 CCTTACAAGAAGAGGAAATCTGG - Intergenic
1102806480 12:115785664-115785686 CCTTACAAGAAGAGAAAATTTGG + Intergenic
1102934495 12:116885012-116885034 CCTCATAAGAAGAGGAAATTAGG + Intergenic
1103230885 12:119329365-119329387 CCTTAGAAGAAGGGGAGATCTGG + Intergenic
1103512514 12:121484969-121484991 CCTTATAAAATGAGGAAATCTGG + Intronic
1103849495 12:123922779-123922801 CCTTATAAGAGGAGGAAATTTGG - Intronic
1103963759 12:124625227-124625249 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1104211927 12:126697272-126697294 CCTCATAAGAAGAGGAAATTTGG + Intergenic
1105673577 13:22645812-22645834 CCTTATACAAAGAGGAAATGAGG - Intergenic
1106219649 13:27735030-27735052 CCTTATAAGAAGAGGAAATGGGG + Intergenic
1106454556 13:29915854-29915876 CCTTATAAGAAGAGGACATTTGG + Intergenic
1106477836 13:30113684-30113706 CCTCATACAAAGAGGAAATCTGG + Intergenic
1106499381 13:30312402-30312424 CCTAACATGTAGAGGTACTCTGG + Intergenic
1106531749 13:30599693-30599715 CTTTATAAGAAGAGGAAATTTGG - Intronic
1107043707 13:35974328-35974350 CCTTACACAAAGAGGGAATTTGG + Intronic
1107411513 13:40162595-40162617 CCTTACATGAAGAGGAGATTAGG + Intergenic
1107651135 13:42546385-42546407 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1107917727 13:45169276-45169298 CCTTATAAGAAAAGGAAATTTGG + Intronic
1108064343 13:46562475-46562497 CCTTATAAGAAGAGGAAATTTGG - Intronic
1108104956 13:46998684-46998706 CCTTATAGGAAGAGGAGATTAGG + Intergenic
1108203362 13:48063447-48063469 CCTTATAAGAAGAGAAAATCTGG + Intronic
1108258444 13:48632849-48632871 CCTTAAAAGAAGAGGAAATTTGG + Intergenic
1108297487 13:49038418-49038440 CCTTATAAGAACAGGAAATTAGG + Intronic
1108299337 13:49058513-49058535 CCTTGTAAGAAGAGGAAATTTGG + Intronic
1108434175 13:50385462-50385484 CCTTACAGGAAGAGGAGATTAGG + Intronic
1108522387 13:51258155-51258177 CCTTACATAAAGGGAAAATTTGG - Intronic
1108529605 13:51316652-51316674 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1109376026 13:61494309-61494331 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1110067984 13:71133128-71133150 CCTTATAAGAAGAGAAAATTTGG - Intergenic
1110687720 13:78395090-78395112 CTTTATATGAAGAGGAGATTAGG - Intergenic
1111926562 13:94469429-94469451 CCTCAAAAGAAGAGGAAATTTGG + Intronic
1112364252 13:98743073-98743095 CCTCACAAAAAGAGGAAATCTGG - Intronic
1112575286 13:100629817-100629839 CCTTACAGAAAGAGGAAATATGG + Intronic
1112584795 13:100708773-100708795 CCTTATAAGAAAAGGAAATTTGG - Intergenic
1112600157 13:100847402-100847424 CCTCAGAAGAAGAGGAAATTAGG - Intergenic
1112682800 13:101786594-101786616 CCTTACACAAAGAGGAAATTAGG - Intronic
1112766661 13:102752945-102752967 CCTTGTAAGAAGAGGAAATTTGG + Intronic
1112975678 13:105314604-105314626 CCTTACAAGAAGAGGAAATTTGG + Intergenic
1113774578 13:112935818-112935840 CCTTATAGAAAGAGGAAATCTGG + Intronic
1114033351 14:18596044-18596066 CCTTACATGAAAACAATATCTGG + Intergenic
1114078146 14:19175244-19175266 CCTTACATGAAAACAATATCTGG + Intergenic
1114125349 14:19719309-19719331 CCTTACATGAAAACAATATCTGG - Intronic
1114183502 14:20383645-20383667 CTGTACATGGAGAGGAAGTCAGG + Intronic
1114404518 14:22443605-22443627 CCTTATAAGAGGAGGAAATTTGG - Intergenic
1114478817 14:23018087-23018109 CCTTATAAGAAGAGGGAATTTGG + Intronic
1115049209 14:29035869-29035891 CCTTGTAAGAAGAGGAAATTCGG + Intergenic
1115268749 14:31527982-31528004 TCTTATAAGAAGAGGAAATCTGG - Intronic
1115306533 14:31939259-31939281 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1115778432 14:36742053-36742075 CCATACAAGAAATGGAAATCAGG - Intronic
1116062354 14:39939765-39939787 TCTTATAAGAAGAGGAAATTTGG + Intergenic
1116421314 14:44736083-44736105 CCTTAAAAGAAGAGGAAATCAGG - Intergenic
1116427125 14:44804990-44805012 CCTTATAAAAAGAGGAAATGTGG + Intergenic
1116589804 14:46757570-46757592 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1116661987 14:47722041-47722063 TCTTATAAGAAGAAGAAATCTGG + Intergenic
1116700319 14:48232784-48232806 ACTTAGAAGAAGAGGAAATTAGG + Intergenic
1116870530 14:50065624-50065646 CCTTATAGGAAGAGGAAAATGGG - Intergenic
1117410128 14:55442850-55442872 CCTCACAAGAAGATGAAATCTGG + Intronic
1117811925 14:59556337-59556359 CCTGACAAAAAGAGGAAATGGGG + Intronic
1117868244 14:60171479-60171501 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1118043252 14:61939588-61939610 CCTCATAAAAAGAGGAAATCTGG - Intergenic
1118071372 14:62249929-62249951 CCTTCTAAGAAGAGGAGATCAGG - Intergenic
1118124021 14:62878872-62878894 CCTTACAATAAGAGGAAATTCGG - Intronic
1118387492 14:65268383-65268405 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1118742775 14:68752478-68752500 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1118926289 14:70192696-70192718 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1118949490 14:70421257-70421279 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1119105053 14:71915864-71915886 CCTTATAAGCAGAGGAAATGTGG + Intergenic
1119595927 14:75933826-75933848 TCTTACAAGAGGAGGAAATATGG + Intronic
1119925321 14:78488152-78488174 CCTTATAACAAGAGGAAATTTGG - Intronic
1119966062 14:78916948-78916970 CCTTATAAGAAGAGGAAACTTGG - Intronic
1120001475 14:79308046-79308068 CCTTATATGAAGAGGTGATTAGG - Intronic
1120072244 14:80116983-80117005 CCTTACCTGAAGAATAAACCTGG + Intergenic
1120715633 14:87838081-87838103 CCTTATAAGAAGAGAAAATTAGG + Intronic
1120839082 14:89067365-89067387 CCTTATAAGAAGAGGACATGAGG + Intergenic
1120872134 14:89347267-89347289 CCTTACAAGAAGGGAAAATTTGG + Intronic
1120960847 14:90123394-90123416 CCTTATAAGAAAAGGAGATCAGG - Intronic
1121066851 14:90975461-90975483 CCTTACAGGAAGAAGAAATTTGG + Intronic
1121274768 14:92659982-92660004 TCTTACAAAAAGAGGAAATTGGG - Intronic
1121454468 14:94029523-94029545 CCTTATAAAAAGAGGAAATTAGG - Intronic
1121561958 14:94882501-94882523 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1121716145 14:96077466-96077488 CCTTATAAGAATAGGAAATTAGG + Intronic
1122161522 14:99787812-99787834 CCTTATAAGAAGGGGAAATTTGG - Intronic
1122907731 14:104809862-104809884 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1124028863 15:25991067-25991089 CCTTACAAGAAGAGGAAATTTGG - Intergenic
1124242365 15:28039732-28039754 CCTTATAAGAAGAGGAAGTTTGG + Intronic
1124352591 15:28968790-28968812 ACTTCCAAGAAGAGGAAATGCGG + Intronic
1124992462 15:34689438-34689460 CCTTATATGAAGAAAAAATTTGG + Intergenic
1124998637 15:34748310-34748332 CCTCATAGGAAGAGGAAATTTGG + Intergenic
1125033597 15:35097637-35097659 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1125168762 15:36741744-36741766 CCTTACAAGAAGAAGAAACTTGG - Intronic
1125283104 15:38064171-38064193 CCTTATAAGAAGAGGAAATCTGG + Intergenic
1126176650 15:45742187-45742209 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1126585944 15:50287499-50287521 CCTTACAGGAAGAGGAGATTAGG + Intronic
1127214470 15:56810226-56810248 CCTTACAAAAAGGGGAAATTTGG - Intronic
1127263457 15:57343097-57343119 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1127344738 15:58083149-58083171 CCTTATAAGAAGAAGAAATCTGG - Intronic
1127646746 15:60966167-60966189 CCTTATAAGAAGAGGAAATGTGG - Intronic
1127663549 15:61122795-61122817 GCTTACATTTAGAGCAAATCAGG - Intronic
1127962586 15:63900756-63900778 CCTTCTAAGAAGAGGAAATATGG + Intergenic
1128458738 15:67850017-67850039 CCTTATTAGAAGAGGAAATCTGG + Intergenic
1129287553 15:74538357-74538379 ACTTACATGATAAGGAAGTCAGG + Intergenic
1129598608 15:76983881-76983903 CCTTCCTTGAAGGGGGAATCTGG + Intergenic
1129923093 15:79337293-79337315 CCTTATATAAAGGGGAAATTAGG - Intronic
1130189721 15:81722171-81722193 CCTTATAAGGAGAGGAAATATGG + Intergenic
1130222294 15:82029902-82029924 CCTTATAAGAAGTGGAAATCTGG + Intergenic
1130303224 15:82696079-82696101 CTTTATAAGAAGAGGAAATTTGG - Intronic
1130905524 15:88238033-88238055 CCTTATAAGAAGAGGAGATTAGG + Intronic
1131051324 15:89349930-89349952 CCTTAGAAGAAGAGGCGATCTGG + Intergenic
1131543189 15:93291742-93291764 TCTTACAAGAAGAGGAAATTTGG - Intergenic
1132021451 15:98366032-98366054 CCTTTCAAAAGGAGGAAATCTGG + Intergenic
1132179792 15:99743656-99743678 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1132331420 15:101014708-101014730 CCTTATAAGAAGAGGAGATTAGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133631236 16:7623843-7623865 TCTTACAAGAAGAGGAGATGAGG - Intronic
1133849512 16:9488883-9488905 CCTTATGAGAAGAGGAAATCTGG + Intergenic
1133856106 16:9550719-9550741 CCTTATAAGAAGAAGAAATTTGG - Intergenic
1133856545 16:9554839-9554861 ACCTATAAGAAGAGGAAATCAGG - Intergenic
1133888624 16:9856150-9856172 CATTGCATGATGAGGAAACCAGG + Intronic
1133977180 16:10607551-10607573 CCTTATGAGAAGAGGAAATCTGG + Intergenic
1134299951 16:12981805-12981827 CCTTATAAGAAGAGGAGATTAGG + Intronic
1134527583 16:14956308-14956330 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1134775853 16:16852823-16852845 CCTTATAAGAAGAGGATATTTGG + Intergenic
1135060932 16:19270814-19270836 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1135201615 16:20442362-20442384 CCTTAGAAGAAGAGGAGATTGGG - Intergenic
1135217493 16:20585504-20585526 CCTTAGAAGAAGAGGAGATTGGG + Intergenic
1135289821 16:21225702-21225724 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1137335272 16:47542264-47542286 CCTTACAAAAAGAAGAAATGGGG - Intronic
1137486780 16:48897918-48897940 CCTGACCTGCAGAGCAAATCTGG - Intergenic
1138145958 16:54612067-54612089 CCTTAGAAGAAGAGGAAATTAGG + Intergenic
1138785994 16:59847352-59847374 CCTTATGAGAAGAGGAAATTTGG - Intergenic
1138948983 16:61887572-61887594 CCTTACATGAAGAGGAAATCCGG - Intronic
1139280294 16:65764774-65764796 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1139350213 16:66330238-66330260 CCTTAAAAGAAGAGGAAGGCCGG - Intergenic
1140350589 16:74258404-74258426 TCTTACAAGAAGAGGGAATTTGG + Intergenic
1140826683 16:78713575-78713597 CCTTATAAAAAGAGGAAATTTGG + Intronic
1140968527 16:79990744-79990766 CCTTATAAAAAGGGGAAATCTGG - Intergenic
1141170944 16:81691303-81691325 CCTTAGAAGAAGAGGAAACACGG - Intronic
1141276580 16:82593848-82593870 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1141535674 16:84678097-84678119 CCTTACAAGAAGAGGCGATTAGG - Intergenic
1141665656 16:85463913-85463935 CCTTCCATGAACAGCAACTCAGG + Intergenic
1141702551 16:85649133-85649155 CCTTATGAGAAGAGGAGATCAGG - Intronic
1143310594 17:5985381-5985403 CCTTATAAGAAGAGGAAATTTGG + Intronic
1143327192 17:6107160-6107182 CCTTACAAGAAGAGGAGGTTAGG - Intronic
1143896911 17:10143628-10143650 CCTTATAAGAAGAGGAAATTAGG + Intronic
1144169038 17:12640920-12640942 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1146315042 17:31800215-31800237 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1146551621 17:33785154-33785176 CCTTATAGGAAGAGGAGATTAGG + Intronic
1147220492 17:38926111-38926133 CCTAACTTGAAGAAGAAATTAGG - Intergenic
1147233638 17:39039377-39039399 TCCTACATGTGGAGGAAATCTGG - Intergenic
1147465760 17:40609415-40609437 CCTTATAGGAAGAGGAGATCGGG - Intergenic
1149126413 17:53239561-53239583 CCTTAGAAGAGGAGGAAATCTGG - Intergenic
1149293765 17:55242062-55242084 CCTCACAAGAAAAGGAAATTAGG - Intergenic
1149388117 17:56162485-56162507 CCTTATAACAAGAGGAAATGTGG - Intronic
1149778028 17:59373380-59373402 GCTTTCATGAAGAGGAAGTAAGG - Intronic
1150296188 17:64008880-64008902 CCTTGCTTGAAGAGGGAATCAGG - Intronic
1150920948 17:69481710-69481732 CCTTATATGAAGAGGAAATTTGG - Intronic
1151249294 17:72821199-72821221 CCTTATAAAAAGGGGAAATCTGG + Intronic
1151385302 17:73751685-73751707 CCTTATAAGAAGAGGATATGTGG - Intergenic
1151883890 17:76912081-76912103 CCTTATAGGGAGGGGAAATCTGG - Intronic
1151903169 17:77030923-77030945 CCTCATAAGAAGAGGAAATTAGG + Intergenic
1152010206 17:77708359-77708381 CCTTATAAGGAGAGGAGATCTGG - Intergenic
1152240449 17:79158091-79158113 CCTTACAAGAAGAGGCGATTAGG + Intronic
1152317459 17:79589417-79589439 CCTTATCTGAAGGGTAAATCAGG - Intergenic
1152536285 17:80951944-80951966 CCTTACAAGAAGAGGCCACCAGG + Intronic
1153050107 18:893970-893992 CCTTACAAAAAGGGGAAATTTGG - Intergenic
1153237150 18:2999293-2999315 CCTTATAAAAAGAGGAAATCTGG + Intronic
1153337945 18:3943847-3943869 CCTTAGAAGAAGAGGAGATTAGG + Intronic
1153512798 18:5873776-5873798 CCTTATATGAAGGGGAAATTTGG + Intergenic
1153599226 18:6762687-6762709 CCTTACATGAAGAGAAGATTAGG + Intronic
1153651079 18:7240869-7240891 CTCTGCATCAAGAGGAAATCTGG - Intergenic
1153663717 18:7349589-7349611 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1154129608 18:11725276-11725298 CCTTATAAGAAGAGGAGATTAGG + Intronic
1155326529 18:24670500-24670522 CCTTATAAGAAGAGGAAACTTGG + Intergenic
1155883179 18:31176140-31176162 CCTTATATAAAGGGGAAATTTGG - Intergenic
1156172413 18:34501877-34501899 TCTTACAAAAAGAGGAAATTTGG - Intronic
1156241564 18:35259538-35259560 CCTTAAAAGAAGAGGAGATTAGG - Intronic
1156617928 18:38810080-38810102 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1157100065 18:44721248-44721270 CCTTGCATGAAGAAGAGCTCTGG + Intronic
1157622574 18:49024883-49024905 CCTTAAAAGAAGAGGAGATTAGG + Intergenic
1157883055 18:51340592-51340614 CCTTAGAAGAAGAGGAAATGTGG - Intergenic
1158274669 18:55754455-55754477 CCTTACAAGAAGAGGAAATTTGG + Intergenic
1158518265 18:58148625-58148647 CCTTCTAAGAAGAGGAAATTTGG - Intronic
1158623795 18:59054786-59054808 CCTTATAAGAAGAGGAAACTTGG - Intergenic
1158747486 18:60218193-60218215 CCTTTTAAGAAGAGGAAATCTGG + Intergenic
1158761292 18:60390643-60390665 CCTTACAAGAAAAGAAAATAAGG - Intergenic
1158839401 18:61367936-61367958 CCTTATAAGAAGAGGACATTTGG - Intronic
1158926130 18:62263047-62263069 CCTTATAAGAAGGGAAAATCTGG - Intronic
1159000013 18:62965285-62965307 CCTTAAAAGAAGGGGAAAACTGG + Intronic
1159456835 18:68669801-68669823 TCTTATATAAAGAGGAAATTTGG - Intergenic
1159461635 18:68728305-68728327 CCTTGAATGAACAGGAAATGAGG - Intronic
1160945294 19:1639729-1639751 CCTGACCTGAAGAGGAAATTAGG + Intronic
1161030065 19:2053809-2053831 CCTTAGAAGAAGAGGAGACCGGG - Intergenic
1161308537 19:3580692-3580714 CCTTATAAGAAGATAAAATCTGG + Intergenic
1161629910 19:5348681-5348703 CCTTATAAAAAGGGGAAATCTGG - Intergenic
1162090908 19:8279446-8279468 CCCTACAAGAAGAAGAAATATGG - Intronic
1162093141 19:8294284-8294306 CCCTACAAGAAGAAGAAATATGG - Intronic
1162538905 19:11281478-11281500 CCTTAAATTAAGAGTAAACCTGG - Intergenic
1162838864 19:13340903-13340925 CCTTATAAAAAGAGGACATCTGG + Intronic
1163101290 19:15098603-15098625 CCTTACGAGAAGAGGAAATTTGG - Intergenic
1164403046 19:27915814-27915836 CCTTACACCAAGAGGAATTGTGG - Intergenic
1164890729 19:31821095-31821117 CCTTCTAAGAAGAGGAAAGCTGG - Intergenic
1165554513 19:36618456-36618478 CCTAACTTGAAGACAAAATCTGG - Intronic
1165737468 19:38185738-38185760 CCTTGCAGAAAGAGGAAATGTGG - Intronic
1166441000 19:42815338-42815360 CCTTATAAGAAGAGGAGATGAGG + Intronic
1166459447 19:42973304-42973326 CCTTATAAGAAGAGGAGATGAGG - Intronic
1166460474 19:42983944-42983966 CCTTATAAGAAGAGGAGATGAGG + Intronic
1166476769 19:43133349-43133371 CCTTATAAGAAGAGGAGATGAGG - Intronic
1166581516 19:43904024-43904046 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1166657009 19:44619744-44619766 CCTTATAAGAAGAGGAAGTTTGG - Intronic
1166919050 19:46216031-46216053 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1167188751 19:47967609-47967631 CCTTATAAGAAGAGAAAATTTGG - Intergenic
1167230788 19:48281823-48281845 CCTTATAAGAAGAGGAAATCTGG - Intronic
1167677621 19:50897252-50897274 CCTAATATGAAGAGGAAAAGAGG + Intergenic
1167794338 19:51699660-51699682 CCTTATGAGAAGAGGAAATTAGG - Intergenic
1168325041 19:55534248-55534270 CCTTATAAGAAGAGGAGATCAGG + Intronic
1168514750 19:57002023-57002045 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1168526077 19:57089828-57089850 CCTTATAAGAAGAGGAGATGAGG + Intergenic
925035718 2:684021-684043 CCTTATAAGAAGAGAAGATCAGG - Intergenic
925055053 2:850919-850941 CCTTATAAGAAGAGGAGATGAGG - Intergenic
925062067 2:899794-899816 CCTTATAAGAAGAGGAAATGAGG - Intergenic
925250295 2:2428966-2428988 TCTTACATTAAGAGGTAAGCAGG + Intergenic
925398462 2:3553919-3553941 CCTTACATGGAGTGAAAATAAGG + Intronic
925515638 2:4677911-4677933 CCTCACAAGAAAAGGAAATCAGG - Intergenic
925725566 2:6867400-6867422 CCTTCCCAGAAGAGGAAATTTGG - Intronic
926149046 2:10414498-10414520 CCTTATAAGAAGAGGAGATGAGG - Intronic
926352146 2:12005596-12005618 CCTTACAAGAAGAGGACATTTGG - Intergenic
926689602 2:15724381-15724403 CCTTATAAGAAGAGGAAATTTGG - Intronic
926870968 2:17416754-17416776 CCTTACAAGAAAAGGAAATTTGG - Intergenic
926966780 2:18423614-18423636 TCTTATAAGAAGAGGAAATGAGG - Intergenic
927264967 2:21136147-21136169 CCTTACATGAAGAAACAACCAGG - Intronic
927382499 2:22495296-22495318 CCTTTTAAGAAGAGGAAATTTGG + Intergenic
927435858 2:23065548-23065570 CCTTATAAGAAGAGGAGATGAGG + Intergenic
927529083 2:23777046-23777068 CCTTACAAGGAGAGAAAATTTGG + Intronic
928066102 2:28166021-28166043 CCTTATAATAAGAGGAAATTAGG + Intronic
928784189 2:34862236-34862258 TCTTATAAGAAGAGGAAATTTGG - Intergenic
928892067 2:36215892-36215914 CCTTATGAGAAGAGGAAATCGGG + Intergenic
929007408 2:37409604-37409626 CCTTATAAGAAGACGAAATTTGG - Intergenic
929034914 2:37681384-37681406 CCTTACAAGAAGAGGAGATTTGG + Intronic
929470078 2:42182918-42182940 CCTTATAAGAAGAGGAAATCTGG - Intronic
930605354 2:53487594-53487616 TCTTACAAGAAGAGGAAATTTGG + Intergenic
931105969 2:59056126-59056148 CCTTAAAAGAAGAGAAAATCAGG + Intergenic
931120331 2:59210627-59210649 CCTTATAAAAAGAGGAAATTTGG - Intergenic
931259423 2:60604310-60604332 CCTTACAACAAGGGGAAATTTGG + Intergenic
931367630 2:61632755-61632777 CCTGACAGGAAGAGGAGCTCAGG - Intergenic
932049739 2:68386699-68386721 CCTTACAGGAAGAAGAGATGGGG - Intronic
932808256 2:74801339-74801361 CCTTATAAGAAGAGGAAATTTGG + Intergenic
933009728 2:77045064-77045086 CTTTACATAAAGAGGTAATATGG + Intronic
933548787 2:83747326-83747348 ACTTACAGGAAGAGGAAATTAGG + Intergenic
934064225 2:88325111-88325133 CCTAAGATAAAGAGCAAATCTGG + Intergenic
934522737 2:95030197-95030219 CCTCACAGGAAGAGGAAGGCAGG + Intronic
934575128 2:95395389-95395411 CCTTATAAGGAGAGGAAATTAGG + Intergenic
935049120 2:99509016-99509038 GTATACATGAAGAGGAAATGAGG + Intergenic
935077520 2:99759969-99759991 CCTTACAACCAGAGGAAATGGGG + Intronic
935237991 2:101153765-101153787 CCTTATAAAAAGAGGAAATTTGG + Intronic
935290881 2:101610123-101610145 CCTTACAAGAAGAGGAGATTAGG + Intergenic
935609502 2:105006314-105006336 CCTTATAAGAAGAGGAGATTAGG - Intergenic
935633005 2:105227398-105227420 CCTTACAAGAAAAGGAAAGGAGG + Intergenic
935796382 2:106645252-106645274 CCTTATAAGAGGAGGAAATTTGG - Intergenic
936016671 2:108964479-108964501 CCCTACTCTAAGAGGAAATCAGG + Intronic
936230031 2:110692511-110692533 CCTTACAGGAAAAGGAAACCTGG + Intergenic
936388057 2:112048029-112048051 CCTTACAAGAAGAGGAGATTAGG - Intergenic
936667828 2:114617976-114617998 TCTGACATGTAGAGAAAATCTGG - Intronic
936822010 2:116533355-116533377 CTTTATAAGAAGAGGAAATTTGG - Intergenic
937014058 2:118587462-118587484 CCTCATAAGAAGAGGAAATCTGG + Intergenic
937256490 2:120559799-120559821 CCTTATAAGAAGAGGACATTTGG - Intergenic
937528460 2:122799774-122799796 CCTGAGAAGAAGAGGAAATTTGG - Intergenic
938105100 2:128524700-128524722 CCTTATATGAAGAGAAGATCAGG + Intergenic
938578400 2:132624251-132624273 CCTTACAGGAAGAGGAAATTTGG - Intronic
938962213 2:136354049-136354071 CCTTTTAGGAAGAGGAAATTTGG + Intergenic
938978637 2:136504544-136504566 CCTTATAAGAAGAGAAAATCTGG - Intergenic
939597725 2:144147733-144147755 CCTTTTATGATGGGGAAATCTGG + Intronic
939770732 2:146313293-146313315 CTTTACATGAAGAGGACCTAGGG - Intergenic
939801676 2:146719157-146719179 CCTTATAAGAAAAGGAAATTTGG - Intergenic
939857600 2:147378646-147378668 CCTGATAAGAAGAGGAAATTAGG + Intergenic
940071387 2:149692138-149692160 CATTATATAAAGAGGAAATTAGG + Intergenic
940073661 2:149717446-149717468 CCTTATAAGAAGATGAAATTAGG - Intergenic
940991260 2:160098943-160098965 CCTTATAAGAAGAGGAGATTAGG - Intergenic
941007321 2:160261423-160261445 CCTTATAAGAAGAGGAAATTTGG - Intronic
941238468 2:163006587-163006609 CCTTATAAGAAGAGGAAATATGG - Intergenic
941254504 2:163211669-163211691 CCATATAAGAAGAGGAAATCTGG - Intergenic
941956390 2:171209711-171209733 CCTTATAAGAAGAGGAAATTTGG + Intronic
941984814 2:171499968-171499990 CCTTATAAGAAGAGGAGATTGGG - Intergenic
942068030 2:172290250-172290272 CCTTATAAGAAGAGGAAATTTGG - Intergenic
942270063 2:174265595-174265617 CCTTATAAGAAGAGGAAATTTGG - Intergenic
942270439 2:174268872-174268894 CCTTATAAGAAGAGGAGATTAGG + Intergenic
942738182 2:179140367-179140389 CCTTATAAGGAGAGGAAATCTGG + Intronic
942752401 2:179302778-179302800 CATTATATGAAAAGGAAATTTGG + Intergenic
942934708 2:181541185-181541207 CCTTATAAGAAGAGGAAATTTGG + Intronic
944311946 2:198243429-198243451 CCTTATAAGAAGAGGAAATTAGG - Intronic
944914971 2:204350341-204350363 CCTTATATGAAGAGGAAGGCAGG - Intergenic
945175334 2:207038038-207038060 CCTTATAAAAAGAGGAAATTTGG + Intergenic
945395509 2:209310865-209310887 CCTTACAGAAAGAGAAAATTAGG + Intergenic
946136080 2:217648288-217648310 CCTTATAAGAAGAGGAAATTTGG - Intronic
946451697 2:219785387-219785409 CCTTACAAGTAGAGGAAATTTGG + Intergenic
946585334 2:221180074-221180096 CCTTATGAGAAGAGGGAATCTGG + Intergenic
946763974 2:223023007-223023029 CCTTATAAAAAGGGGAAATCTGG - Intergenic
947016111 2:225621869-225621891 CCTTACAAAAAAAGGAACTCTGG - Intronic
947410615 2:229834854-229834876 TCTTACATGAAGAGCTAATGTGG + Intronic
947521093 2:230846654-230846676 CCTTATAAGAAGAGGAGATTCGG - Intergenic
947597469 2:231422287-231422309 CTTTATAAGAAGAGGAAATTTGG - Intergenic
947813246 2:233018433-233018455 CCTTATAAGAAGAGAAAATTAGG - Intergenic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948524832 2:238565046-238565068 CCTTATAGGAAGAGGAAATTGGG + Intergenic
1169078965 20:2782998-2783020 CCTTATAAGAAGAGGAGGTCGGG - Intergenic
1169675211 20:8145275-8145297 CCTTATAAGAAGAGAACATCTGG - Intronic
1169696272 20:8390313-8390335 CCTTATTAGAAGAGGAAATTAGG - Intronic
1170015279 20:11774373-11774395 CCTCATAAGAAGAGGAGATCAGG + Intergenic
1170073376 20:12392724-12392746 CATTATAAGAAGAGGAAATGTGG + Intergenic
1170167031 20:13370744-13370766 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1170498292 20:16948281-16948303 CCTTATAAGGAGAGGAAATTAGG + Intergenic
1170534092 20:17323252-17323274 CCTTATAAGAAGAGGAGATTAGG + Intronic
1170753174 20:19170805-19170827 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1170804586 20:19618433-19618455 CCTTATAAGAACAGGAAATTAGG - Intronic
1171184096 20:23112360-23112382 CCTTACGAGAAGAGGAGATGAGG - Intergenic
1171194580 20:23187209-23187231 CTTTACAGGAAGGGGAGATCTGG - Intergenic
1172341446 20:34161180-34161202 CTTTATAAGAAGAGGAAATTTGG - Intergenic
1172909835 20:38399798-38399820 CCTTATAAGAACAGGAAATCTGG + Intergenic
1173014346 20:39211313-39211335 TCTTTCAAGAAGAGGAAATTTGG + Intergenic
1173042286 20:39475662-39475684 CCTTATAAGAAGAGGAAAAGTGG - Intergenic
1173124574 20:40324941-40324963 CCTTACAAGAAGAGGTGATTTGG - Intergenic
1173180296 20:40801546-40801568 TCTTACAGGAAGAGGAAATTTGG - Intergenic
1173254519 20:41384696-41384718 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1173292921 20:41730049-41730071 CCTTACCTGAAAAAGAAATGGGG - Intergenic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1173889910 20:46498836-46498858 CCTTATAACAAGGGGAAATCTGG + Intergenic
1174883943 20:54310860-54310882 CCTTATAAGAAGAGGAGATAAGG - Intergenic
1174886320 20:54339263-54339285 CCTGACAGGAAGTGGAACTCAGG + Intergenic
1174921969 20:54713028-54713050 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1175287732 20:57848977-57848999 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1175518549 20:59584862-59584884 CCTTATATGAAGAAGAGATTTGG - Intronic
1175687502 20:61042207-61042229 CCTTATAAGAAGAGAAAATTAGG + Intergenic
1176972294 21:15280803-15280825 CCTTACATGAAAATGAAATAAGG - Intergenic
1176997951 21:15578726-15578748 CCTTGAATGAAGAGGAAGCCAGG + Intergenic
1177155894 21:17501132-17501154 CCCTTCATGAGGAGGAAATGAGG + Intergenic
1177207386 21:18025850-18025872 CCTTATAAGAACAGGAAATTTGG - Intronic
1177210638 21:18066803-18066825 CCTTATAAGAAGACGAAATTTGG + Intronic
1177836201 21:26188731-26188753 CCTCACAAGAAGAGGAAATTAGG + Intergenic
1177853528 21:26376875-26376897 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1178142415 21:29699362-29699384 CCTTATAAGAAGGGAAAATCTGG + Intronic
1178316286 21:31569355-31569377 CCTTATAAGAAGAGGAAGTTTGG - Intergenic
1178355154 21:31905150-31905172 CTTTATAAGAAGAGGAAATTTGG + Intronic
1178368782 21:32009886-32009908 CCTTATAAGAAGGGGAAATTGGG + Intronic
1178433130 21:32534168-32534190 GCTTTCATGAAAAGGAAACCCGG + Intergenic
1178637340 21:34315805-34315827 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1178763122 21:35423029-35423051 CCTTATAAAAAGAGGAAATTTGG + Intronic
1178846101 21:36175410-36175432 CCTTGTAAGAAGAGGAAATCTGG - Intronic
1178898343 21:36579136-36579158 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1179019881 21:37629538-37629560 CCTTATAAGAAGAGGAAATTAGG + Intronic
1179085770 21:38216281-38216303 CCTTACAAAAAGAGGAAATTTGG - Intronic
1179119297 21:38528172-38528194 CCTTATGAGAAGAGGAAATTTGG - Intronic
1179136020 21:38680579-38680601 CCTTAAAGGAAGAGAAAATTTGG - Intergenic
1179363132 21:40731635-40731657 CCTTATAAGAAGAGGAAATTAGG - Intronic
1179364096 21:40739546-40739568 CCTTATAAGAAGAGGAGATTAGG - Intronic
1179430837 21:41319966-41319988 CCTTATAAGAAGAGGAGATGAGG + Intronic
1179646596 21:42779703-42779725 TCTTACAAGAAGAGGAGGTCGGG + Intergenic
1179660424 21:42871081-42871103 CCTTTCAGGAACAGGAAATGAGG + Intronic
1179708939 21:43200735-43200757 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1180457466 22:15523099-15523121 CCTTACATGAAAACAATATCTGG + Intergenic
1180632961 22:17242377-17242399 CCTTATAGGAACAGGAAATTCGG - Intergenic
1180911247 22:19452275-19452297 CCTTTTAAGAAGAGGAAATTTGG - Intronic
1181078536 22:20397936-20397958 CCTCATAAGAAGAGGAAATTTGG - Intronic
1181303894 22:21903180-21903202 CCTAACATGCAGAGCAAATAGGG - Intergenic
1182208208 22:28650166-28650188 CCACACATGAAAAGGCAATCAGG + Intronic
1182240900 22:28915311-28915333 CCTTATAAGAAGAGAAAATTTGG - Intronic
1182768235 22:32774319-32774341 CCTCATAAGAAGAGGAAATTTGG + Intronic
1182892868 22:33833412-33833434 CCTTATAAGAAGAGGAGATAAGG + Intronic
1182910300 22:33978656-33978678 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1183266012 22:36825945-36825967 CCTTACAAGCAGAGGAGATTAGG + Intergenic
1184622630 22:45693753-45693775 CCTTATAGGAAGAGGAAATTAGG + Intronic
1184762829 22:46554592-46554614 CCTAAAACGGAGAGGAAATCTGG + Intergenic
949306415 3:2646818-2646840 CCTTATAAGAAGAGGAAATTTGG - Intronic
949373359 3:3359889-3359911 CCTTAGAAGAAGAGAAAAACTGG - Intergenic
949574481 3:5325447-5325469 CCTTATGAAAAGAGGAAATCTGG + Intergenic
949597716 3:5565397-5565419 CCTTCCATGGAGTGGAAATGGGG + Intergenic
949763359 3:7498040-7498062 AACTACATGATGAGGAAATCTGG - Intronic
949840483 3:8314658-8314680 CCTTACAAGAAGAGGGAATTTGG + Intergenic
950312267 3:11968953-11968975 CCTAATAAGAAGAGAAAATCTGG + Intergenic
950339649 3:12231398-12231420 CCTTCTATGAACAGGAAATTTGG - Intergenic
950445290 3:13033975-13033997 CCTTATAAGAAAAGGAAATTGGG - Intronic
950749373 3:15116808-15116830 CCTTATAGGAAGAGGGAATTAGG - Intergenic
950857240 3:16116989-16117011 CCTTACAAGCAGAGGAGATTAGG - Intergenic
951145222 3:19218866-19218888 CCTTATAAAAAGAGGAAATTTGG - Intronic
951247626 3:20359381-20359403 CATTACATGAACATGAAATGAGG - Intergenic
951323872 3:21279468-21279490 CCTTAAAAGTACAGGAAATCAGG - Intergenic
951531027 3:23698227-23698249 CCTTATAAGAAGAGGAAATTTGG + Intergenic
951627294 3:24679891-24679913 CCTTAAAAGATGAGGAACTCTGG - Intergenic
951657547 3:25026517-25026539 CCTTATAAGAATAGGAAATTTGG - Intergenic
951965732 3:28382371-28382393 CCTTGGAAGAAGAGGAAATTTGG - Intronic
952218611 3:31302192-31302214 CCTTAAAAGAAGAGGAGATTAGG - Intergenic
952695210 3:36257456-36257478 CCTCATCTGAAGGGGAAATCAGG + Intergenic
952710861 3:36430834-36430856 CCTTGTAAGAAGAGGAAATTTGG - Intronic
952928139 3:38336857-38336879 CCTTATAAGAAGAGGAAAATTGG - Intergenic
953065364 3:39464794-39464816 CCTTACACAAAGAAGAAATTTGG - Intergenic
953236697 3:41113306-41113328 CCTTATAAGAAGAGGAGATTAGG + Intergenic
954033152 3:47834758-47834780 CCTTTAAAGAAGAGGAGATCTGG - Intronic
955081893 3:55665488-55665510 CCTTATAAGAAGGGGAAATTTGG + Intronic
955167802 3:56531635-56531657 CCTTATAAGAAGAGGAAATTTGG - Intergenic
955168217 3:56536223-56536245 CCTTTTAAGAAGAGGAAATTTGG - Intergenic
956174539 3:66460522-66460544 CTTTATAAGAAGAGGAAATCTGG + Intronic
956568734 3:70670247-70670269 CCTTATAAGAAGAGGAAATATGG - Intergenic
956811976 3:72872320-72872342 CCTTACAAGAAGAGGAAAGGAGG - Intergenic
957589725 3:82180403-82180425 CCTTATAAAAAGAGGAAATTCGG - Intergenic
958112213 3:89162931-89162953 CCTTCAATGAAGAGGTATTCAGG + Intronic
958114008 3:89190840-89190862 CCTTATAAGAAGAGGAAATTTGG - Intronic
958567243 3:95830074-95830096 CCTTATAAGAAGAGGAAATGTGG + Intergenic
958680355 3:97322333-97322355 CCTTCCATAAACAGGAAATGTGG - Intronic
958790678 3:98647480-98647502 CCTTATAAGAAGAGGAAATCTGG - Intergenic
958860433 3:99438660-99438682 CCTTAAAAGAAGAGGAAATTAGG + Intergenic
958979570 3:100705668-100705690 CCTTATAAGAAGAGGAGATTAGG - Intergenic
959236776 3:103733550-103733572 CCTTAGAAGAAGAGGATATTTGG - Intergenic
959325070 3:104926891-104926913 CCTTTCATGAAGAAGGCATCTGG - Intergenic
959362912 3:105417158-105417180 CCTTCCTGGAAGAGGAAATGGGG - Intronic
960012222 3:112846780-112846802 CCTTATAAAAAGAGGAAAACTGG + Intronic
960018141 3:112916517-112916539 CCTTATATAAAGAGGGAATTTGG + Intergenic
960617140 3:119606328-119606350 CTTTATATAAAGAGGAAATTTGG - Intronic
960725189 3:120662943-120662965 CCTTATAAGAAGAGGAAATTTGG + Intronic
960908563 3:122625626-122625648 CCTTATAAGAAGAGGACATTAGG + Intronic
961015577 3:123465682-123465704 CCTTATAAGAAGAGGAAATTTGG + Intergenic
962159117 3:132980230-132980252 CCTTATATAAAGGGGAAACCTGG + Intergenic
962215440 3:133516929-133516951 CCTTATAAGAAGAGGAGATTAGG - Intergenic
962254086 3:133858572-133858594 CCTTATAAGAAGAGGAGATGAGG - Intronic
962273830 3:133997469-133997491 TCTTACAAAAAGAGGAAATTTGG + Intronic
962282417 3:134061910-134061932 CCTTATAAGAAGAGGAATTTTGG - Intergenic
962910731 3:139847271-139847293 CCTTACCAGAAGAGAAAATTTGG + Intergenic
962964064 3:140337425-140337447 CCTTAAAAGAAGAGGAGATTTGG - Intronic
963296387 3:143551063-143551085 CCTTACAAAAAGAGGAAATTTGG + Intronic
963654203 3:148024633-148024655 TCTTACAAGAAGAGAAAATTAGG + Intergenic
963728957 3:148952356-148952378 CCTTATAAGAAGAGGCAATTAGG - Intergenic
963829249 3:149989726-149989748 CCTTACAAGAGGAGGACATTAGG - Intronic
964111909 3:153096625-153096647 CCTTTTAAGAAGAGGAAATTTGG + Intergenic
964719970 3:159761642-159761664 CCTTGCATGAAGAGAAAAGAAGG + Intronic
965779953 3:172274827-172274849 CCTTAGAAGAGGAGGAAATTCGG - Intronic
966069749 3:175861245-175861267 CCTTATAAGAAGAGGACATTAGG + Intergenic
966728402 3:183129924-183129946 CCTTACACAAAGAGGACATATGG + Intronic
966733169 3:183167560-183167582 CCTTATAAGAAGAGGAGATTAGG - Intergenic
967185659 3:186942368-186942390 CTTTAGATGATCAGGAAATCTGG + Intronic
967842273 3:194016085-194016107 CCTTATGAGAAGAGGAAATTGGG - Intergenic
967964305 3:194949022-194949044 CCTTATAAGAAGAGGAAATTTGG + Intergenic
967964437 3:194949932-194949954 CCTTATAAGAAGAGGAAATTTGG - Intergenic
967968231 3:194979465-194979487 CCTTAAAAGAAGAAGAAATTTGG - Intergenic
968280140 3:197471011-197471033 CCTTATAATAAGAGGAAATTCGG - Intergenic
968745802 4:2359504-2359526 CCTTATAAGAAGAGGAAATATGG + Intronic
969322714 4:6422674-6422696 CCTTATAAGAAGAGGAGATTAGG - Intronic
969482878 4:7456114-7456136 CCTTATAAGAAGAGGAGATCAGG - Intronic
969502896 4:7564410-7564432 CCTTACAGAAAGGGGAAATTTGG - Intronic
969515600 4:7646466-7646488 CCTTATAAGAAGAGGAGATCAGG + Intronic
969677180 4:8620586-8620608 CAATACAAGAAGAGGAAATGTGG - Intergenic
969678133 4:8626225-8626247 CAATACAAGAAGAGGAAATGTGG - Intergenic
969679088 4:8631862-8631884 CAATACAAGAAGAGGAAATGTGG - Intergenic
969859507 4:10024422-10024444 CCTTATAGGAAGAGGAAATGAGG + Intronic
969967322 4:11010677-11010699 CTTTACATAAAGAGAAAATTTGG + Intergenic
970025575 4:11620780-11620802 CCTTATAAGAAGAGAAAATTTGG + Intergenic
970077538 4:12241472-12241494 CCTTATAATAAGAGGAAATTAGG + Intergenic
970638523 4:18037177-18037199 CCTTACAAGAAGAGGAGATTAGG + Intergenic
970857743 4:20668138-20668160 CCTTAGAAGAAGAGAAAATTTGG + Intergenic
970917370 4:21351690-21351712 CCTTATAAGAAAAGGAAATTAGG + Intronic
971022468 4:22551089-22551111 CCTTGTCTGAAGAGCAAATCTGG - Intergenic
971290969 4:25339125-25339147 CCTTAAAAGAAGAGGAAATTTGG - Intronic
971361098 4:25939359-25939381 CCTTATATGAAAAGAAAATTAGG + Intergenic
971450413 4:26795205-26795227 CATTCCAGGACGAGGAAATCTGG - Intergenic
971528116 4:27648398-27648420 CCTTATATTAAGAGGGAATTTGG - Intergenic
972184330 4:36510536-36510558 CCTTATAAGAAGAGGAAATGTGG + Intergenic
972380072 4:38511313-38511335 CCTTATAAGAAGAGGAAATTTGG - Intergenic
972662157 4:41126791-41126813 CCTTATAAGAAGAAGAAATTAGG - Intronic
973188421 4:47358593-47358615 CCCTAAAAGAAGAGGAAATTTGG - Intronic
973242920 4:47977247-47977269 CCTTATAAGAAGAGGAAACGTGG + Intronic
973838588 4:54837343-54837365 CCTTATAAGAAGAGGAGATTAGG + Intergenic
973839511 4:54846593-54846615 CCTTATAAGAAGAGGAGATTAGG - Intergenic
973960041 4:56100670-56100692 CCTCATAAGAAGAGGAAATTTGG + Intergenic
973998902 4:56490162-56490184 CCACACATGTAGAGGAAAGCAGG - Intronic
974589633 4:63927685-63927707 CCTCATAAGAAGAGGAAATTTGG - Intergenic
975430757 4:74288062-74288084 CCTTCTAAGAAGAGGAAATTTGG - Intronic
975749929 4:77512574-77512596 CCTTATAAGAAGAGAAAATTTGG - Intronic
976028474 4:80721471-80721493 CCTTATAAGATGAGGAAATGAGG - Intronic
976047420 4:80967632-80967654 CCTTATAAGAAGAGCAAATTTGG - Intergenic
976273476 4:83252697-83252719 CCTTACAAGAAGAGGAGTTGAGG - Intergenic
976496313 4:85733751-85733773 CCTTATAAGAAGAAGAAATTAGG - Intronic
976574007 4:86647749-86647771 CCTTATAAGAAGAGGAAATTAGG + Intronic
976663846 4:87569107-87569129 CCTTATAAGAAGAGGAGATTAGG - Intergenic
976721697 4:88175025-88175047 TCTTATATGAAGAGGAAATTCGG + Intronic
976816122 4:89149620-89149642 CCTTATAAGAAGGGGAAATTTGG + Intergenic
976888656 4:90016773-90016795 CCTTATAAGAAGAGGAGATTTGG + Intergenic
977303885 4:95299193-95299215 CCTTATAAGAAGAAGAAATTTGG + Intronic
977399832 4:96518946-96518968 CCTTATAAAAAGAGGAAATCTGG - Intergenic
977715270 4:100175101-100175123 CCAGACATGAAGAGGGAACCTGG - Intergenic
977715769 4:100181840-100181862 CCTTATAGGAAGAGGAGATTAGG + Intergenic
977751620 4:100616522-100616544 CCTTAAAAGAAGAGTAAATTTGG - Intronic
978348548 4:107797498-107797520 CCTTATAAAATGAGGAAATCTGG + Intergenic
979625451 4:122840026-122840048 CTTTATAAGAAGAGGAAACCTGG - Intronic
979682430 4:123476668-123476690 CCTTATAAGAAGAGGAGATTAGG - Intergenic
979965581 4:127073071-127073093 CCATAGATAAGGAGGAAATCAGG - Intergenic
980812546 4:137901407-137901429 CCTTATAAGAAGAGGAGACCCGG - Intergenic
980961586 4:139481279-139481301 CCCTATGAGAAGAGGAAATCTGG - Intergenic
981144756 4:141311461-141311483 CCTTAGACTAAGAAGAAATCTGG + Intergenic
981842974 4:149133845-149133867 CCTTATAAGAAGAGGAAATGTGG + Intergenic
982100033 4:151958671-151958693 CCTTACAAGAAGAGGGAATTTGG - Intergenic
982446129 4:155492471-155492493 CCTCACAAGAAGAGGAGATTTGG + Intergenic
983436464 4:167721819-167721841 CCATCAATGAAGAGGAAAACGGG - Intergenic
983512347 4:168622170-168622192 CCTCACATGCAGACAAAATCTGG + Intronic
983803813 4:171968472-171968494 CCTTACAGGAAGAGGAAGAAAGG - Intronic
984024667 4:174528882-174528904 CCTTATAAGAAGAGGAAATTTGG - Intergenic
984049050 4:174841360-174841382 CCTTATAAGAAGAGGAGATTAGG - Intronic
984049252 4:174843410-174843432 CCTTATATAAAGAGGAAATTTGG + Intronic
984152932 4:176156938-176156960 ACTTATAAGAAGAGGAAATCTGG - Intronic
984589528 4:181601526-181601548 CCTTATAAGAAGAGGACATTAGG - Intergenic
984599140 4:181706203-181706225 CCTTATAAGAAGAGGAGATTTGG - Intergenic
984838127 4:184041038-184041060 CTTTTCAAGAAGAGGAAATTTGG + Intergenic
985245667 4:187977524-187977546 CCTTATACGAAGAGGAAACAGGG + Intergenic
985690973 5:1312123-1312145 CCTTATAAGAAGGAGAAATCTGG + Intergenic
985724448 5:1508446-1508468 CCTTATAAGAAGAGGAGATGAGG + Intronic
985873346 5:2576777-2576799 CCTAACAGGAAGAGGAGATGAGG + Intergenic
986297825 5:6454366-6454388 TCTTACACGAAGAGGAGATTAGG - Intronic
986513892 5:8540900-8540922 TCTTACAAGAAGGGGAAATTGGG - Intergenic
986576585 5:9219552-9219574 CCTTATAAGAATAGGAAATTAGG + Intronic
986778927 5:11046235-11046257 CCTTACAGAAAGGGGAAATTTGG + Intronic
986943079 5:12980334-12980356 CCTTAGAAGAAGAGGAAATTAGG + Intergenic
986977710 5:13411830-13411852 CCTTATAAGAAGAGGAAATTAGG + Intergenic
987095605 5:14546561-14546583 CCTTACAAGAAGAGAAGATAAGG + Intergenic
987244379 5:16033704-16033726 CCTTATAAGAAGAGGAAATTAGG + Intergenic
987253404 5:16123296-16123318 CCTTATAAGAAGAGGAGATTAGG + Intronic
987362886 5:17122527-17122549 CCCTATAAGAAGAGGAAATGTGG + Intronic
987826758 5:23040146-23040168 CCTTACACAAAGGGGAAATTTGG + Intergenic
987834933 5:23147622-23147644 CTTTACATGGTGAGGAAAACAGG - Intergenic
988036939 5:25839548-25839570 CTTTACAACAAGAAGAAATCTGG + Intergenic
988094224 5:26582314-26582336 CATTATATGAAGAGAGAATCTGG + Intergenic
988303947 5:29470374-29470396 CCTAACATGCAGCGGAAACCTGG - Intergenic
988360684 5:30232859-30232881 CCTTTTAAGAAGAGGAAATTAGG + Intergenic
988414050 5:30923521-30923543 CCTTATAAGAAGGGGAAATTTGG + Intergenic
988660170 5:33257788-33257810 CCTTACAAGAAGAGGAAATTTGG + Intergenic
988707652 5:33741396-33741418 CCTCATAAGAAGAAGAAATCTGG - Intronic
988998902 5:36740997-36741019 CCTTATAAGAAGAAGAAATTAGG - Intergenic
989094618 5:37770297-37770319 CTTTATAAGAAGAGGAAATTTGG + Intergenic
989364516 5:40640616-40640638 CCTTATAAGATGAGGAAATCTGG + Intergenic
989437186 5:41428427-41428449 CATTATAAGAAGAGGAAATTTGG + Intronic
990335126 5:54764889-54764911 CCTTATAAGAAAAGGAAATGTGG - Intergenic
990575045 5:57116064-57116086 CTTTAGAAGAAGAGGAGATCTGG - Intergenic
991446673 5:66707606-66707628 TCTTATAAGAAGAGGAAATTAGG - Intronic
991525431 5:67551829-67551851 CCTTATAAGAAGAGGATATTAGG - Intergenic
991937516 5:71816568-71816590 TCTTATAAGAAGAGGAAACCTGG - Intergenic
992202438 5:74397663-74397685 CCTTATAAGAAGAGGGAATTTGG - Intergenic
992255571 5:74917704-74917726 CTTTATAAGAAGAGGACATCTGG - Intergenic
993003873 5:82410513-82410535 CCTTATAAGAAGAGAATATCTGG + Intergenic
993004887 5:82419275-82419297 CCTTAGAAGAAGAGAAAATCTGG + Intergenic
993140826 5:84031078-84031100 CCTTAAAAGAAGAGGAGATTAGG - Intronic
993777870 5:92024171-92024193 AGTTACATGCAGAAGAAATCTGG + Intergenic
993874327 5:93288743-93288765 CCTTATAAGAAGAGGAGATAAGG - Intergenic
994251786 5:97544231-97544253 CCTTATATGAAGAGGAGATTAGG + Intergenic
994282501 5:97922279-97922301 CCTTATAAGAAGAGGAAATTTGG - Intergenic
995012558 5:107274291-107274313 CCCTACAAGAAGAGGAGATTAGG + Intergenic
995304859 5:110633144-110633166 TCATACATGAAGAAGAAATAAGG + Intronic
995321944 5:110844687-110844709 TCTTACAAGAAGAGGACATCTGG + Intergenic
995424162 5:112001384-112001406 CCTTATAAGAAGAGGAAATTTGG - Intergenic
995686625 5:114779544-114779566 CCTTAGATGAAGAGGGGATATGG - Intergenic
995874001 5:116771257-116771279 CTGTACCTGAAGAGGGAATCTGG - Intergenic
996534971 5:124568273-124568295 CCTTATAAGAAAAGGAAATCTGG + Intergenic
996567416 5:124894097-124894119 CCTTATAAGAAGAGGAAATTTGG - Intergenic
996771598 5:127092368-127092390 CCTTATAAGAAGAGGAAATTTGG + Intergenic
998360409 5:141581123-141581145 CCTTATAAAAAGAGGAAATTTGG + Intronic
998655531 5:144174389-144174411 CATCACATGAAGTGGAGATCTGG + Intronic
999012468 5:148057779-148057801 CCTTACTAGAAGAGGAAATTTGG - Intronic
999592917 5:153168402-153168424 CTTTACAGAAAGAGGAAATTTGG - Intergenic
999849010 5:155517255-155517277 CCTTATAAAAAGGGGAAATCTGG - Intergenic
999866562 5:155706363-155706385 CCTTACAAGAAGAGGAGATTTGG - Intergenic
1000017332 5:157289612-157289634 CCTTATAAAAAGAGGAAATCTGG - Intronic
1000086993 5:157896328-157896350 CCTTTTCAGAAGAGGAAATCTGG + Intergenic
1000353045 5:160367506-160367528 CGTTACATTAAGAGGAGATCAGG + Intronic
1000681944 5:164196094-164196116 TCTTAAAAGAAGAGGAAATTTGG - Intergenic
1000973362 5:167738811-167738833 CCTTATAAGAAGAGGAAATTTGG - Intronic
1001125171 5:169012783-169012805 GCTTACATGAAGAGGCAGTGAGG + Intronic
1001338831 5:170825179-170825201 TCTTATAAGAAGAGGAAATTTGG - Intergenic
1001581688 5:172802829-172802851 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1001707257 5:173750516-173750538 CCTTACAAGAAGAGGAAATTAGG + Intergenic
1001869677 5:175140421-175140443 TCTTATAAGAAGAGGAAATTAGG + Intergenic
1002706322 5:181162782-181162804 CCTTATAAGAGGAGGAAATGTGG + Intergenic
1002886914 6:1305531-1305553 CCTTATAAGAAGAGGAAATGTGG + Intergenic
1002906426 6:1452868-1452890 CCTTATAAAAAGAGGAAATCAGG - Intergenic
1003265610 6:4562723-4562745 CCTTACAAGAAGAGGAGATGAGG + Intergenic
1003311249 6:4971682-4971704 CCTCATAAGAAGAGGAAATTTGG - Intergenic
1003368125 6:5496668-5496690 CCTTACAAGAAGAAGAGATTAGG - Intronic
1003466226 6:6382684-6382706 CCTTATAAGAAGAGGAAACTTGG - Intergenic
1003498644 6:6686453-6686475 CCTTATAGGAAGAGGAGATGAGG - Intergenic
1003617751 6:7670710-7670732 CCTTATAAGAAAAGGAAATTAGG - Intergenic
1003970654 6:11296058-11296080 CCTTATAAGAAGAGGAGATGAGG + Intronic
1004088991 6:12480131-12480153 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1004298407 6:14435194-14435216 CCTTGAATGAAGAGGAAGTTGGG + Intergenic
1005052522 6:21698031-21698053 CTTTAAAAGAAGAGGAAATTTGG - Intergenic
1005146376 6:22695212-22695234 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1005427209 6:25715407-25715429 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1005647728 6:27857148-27857170 CCTTTTAAGAAGAGGAAATTTGG + Intronic
1005656955 6:27948995-27949017 GCTCACATTAAGAGGAAATGAGG - Intergenic
1005882667 6:30072796-30072818 ACTTACAAAAAGAGGAAATTTGG + Intronic
1006858750 6:37155066-37155088 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1007839988 6:44708264-44708286 CCTTACAAGAAGAGGAAATTTGG - Intergenic
1008549069 6:52610333-52610355 CCTGACAGGCAGAGGGAATCCGG + Intergenic
1009263505 6:61525596-61525618 TCTTATAAGAAGAGGAAATCTGG - Intergenic
1009724426 6:67519252-67519274 CCTTAAAAGAAGAGAAAATCTGG + Intergenic
1010068991 6:71720984-71721006 CCTTTCAAGAAGAGGAAATTAGG - Intergenic
1010108985 6:72202430-72202452 CCTTACAAGAAGAGGAAATTTGG - Intronic
1010273318 6:73939642-73939664 CCTTATAAGGAGAGGAAATTAGG + Intergenic
1010274871 6:73957646-73957668 CCTTACTAGAAGAGGAAATTAGG - Intergenic
1010931960 6:81814584-81814606 CCTTCTAAGAAGAGGAAATTAGG - Intergenic
1011056964 6:83215621-83215643 CCTTAAGAGAAGAGGAAATTTGG + Intronic
1011221945 6:85064099-85064121 CCTTACAAGAAGAGAAAATTTGG + Intergenic
1011407475 6:87031071-87031093 CCCTACAGGAAGAGCAAATTTGG - Intergenic
1011495441 6:87932798-87932820 CCTTAAATGAACATGAACTCTGG + Intergenic
1011790443 6:90893170-90893192 CCTTATAAGAAAAGGAAATTTGG - Intergenic
1011818476 6:91222036-91222058 ACATACATTAAGAGGAAATAAGG - Intergenic
1012044160 6:94248313-94248335 CCTTATATGAAGAGGAAATTTGG - Intergenic
1012482337 6:99680921-99680943 CCTTATAAGAAGAGGAAAATTGG + Intergenic
1013260670 6:108438401-108438423 CCTTATGAGAAGAGGAAATGTGG - Intronic
1013346235 6:109263330-109263352 CCTTATAAGAAGAGGAAATTCGG + Intergenic
1013447960 6:110250371-110250393 CCTTATAAAAAGAGGAAATTTGG - Intronic
1013752489 6:113423423-113423445 ACATACAAGAAGAAGAAATCGGG - Intergenic
1014060727 6:117068922-117068944 ACTTACAAAAAGGGGAAATCTGG + Intergenic
1014143166 6:117966746-117966768 CTTTACAAGAAGAGGAAATTTGG - Intronic
1014597976 6:123369228-123369250 CCTTAAAAGAAGAGGAAATTTGG - Intronic
1014707213 6:124762292-124762314 CCTTATGAGAAGAGGAAATTTGG - Intronic
1014947044 6:127511066-127511088 CCTTACAAAAAGGGGAAGTCTGG + Intronic
1014961683 6:127694664-127694686 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1015136013 6:129871652-129871674 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1015678604 6:135779458-135779480 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1016035735 6:139380865-139380887 CCTCATAAGAAGAGGAAATTTGG - Intergenic
1016240882 6:141929127-141929149 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1016516387 6:144897157-144897179 CCTTATAAGAAGAAGAAATTTGG - Intergenic
1016740997 6:147528436-147528458 CCTTATAAGAAGAGGAGATTAGG - Intronic
1016903029 6:149120723-149120745 CCTTATAAAAAGAGGAGATCAGG + Intergenic
1017035918 6:150267160-150267182 CCTTACAAGAAGGGGAAATTTGG - Intergenic
1017066421 6:150533303-150533325 CCTTACAAGAAGAGGAGATTAGG + Intergenic
1017937081 6:159015214-159015236 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1017938848 6:159033192-159033214 CCTTAGAAGAAGGGGAAATTTGG + Intergenic
1018035098 6:159874984-159875006 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1018200251 6:161387862-161387884 CCTTACAAGATGAGGAGATTAGG + Intronic
1018533788 6:164797271-164797293 CCTTACAAAGACAGGAAATCAGG + Intergenic
1018890794 6:167980114-167980136 CCTTACAAGAGGAGGAAATCTGG - Intergenic
1019159596 6:170060506-170060528 CCTTAAATGTTCAGGAAATCAGG - Intergenic
1019421720 7:954045-954067 CCGCACAGAAAGAGGAAATCGGG - Intronic
1019459967 7:1152643-1152665 CCTTACAAAAAGGGGAAGTCGGG + Intronic
1019551148 7:1603285-1603307 TCTTATATGAAGAGGAGATCAGG + Intergenic
1019554904 7:1624393-1624415 CCTTCTAAGAAGAGGAAATCAGG - Intergenic
1019559478 7:1648830-1648852 CCTTGTAAGAAGAGGAGATCAGG - Intergenic
1019791260 7:3015446-3015468 CCTTATAAGAAGAGGAAATGAGG - Intronic
1019800021 7:3081453-3081475 CCTTATAAGAAGAGAAGATCAGG + Intergenic
1019826539 7:3289263-3289285 CCTTATAAAAAGAGGAAATTAGG - Intergenic
1020108594 7:5434910-5434932 CCTTATAAGAAGAGGAGATTAGG - Intronic
1020130185 7:5555247-5555269 CCTTTTATGGAGAGGAACTCGGG - Intronic
1020361892 7:7335651-7335673 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1021033930 7:15773821-15773843 CCATACAAAAAGAGGAAATTAGG - Intergenic
1021126386 7:16854905-16854927 CCTTATATAAAGAAGAAATTTGG - Intergenic
1021602073 7:22374108-22374130 CTATATAAGAAGAGGAAATCTGG - Intergenic
1021611760 7:22464629-22464651 CCTTATAAGAGGAGGAAATTTGG + Intronic
1021816132 7:24449276-24449298 CTTTACAAGAAGGGGAAATTTGG - Intergenic
1021971622 7:25970731-25970753 CCTTATAAAAAGAAGAAATCTGG - Intergenic
1021972603 7:25980516-25980538 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1022130796 7:27402599-27402621 CCTTACAAGAAGAGGTGATTAGG - Intergenic
1022498774 7:30869626-30869648 ACTTGGAAGAAGAGGAAATCTGG - Intronic
1023225914 7:37968839-37968861 CCTTATATAAGGAGGAAATTTGG - Intronic
1023296190 7:38717225-38717247 CCTTATAAGAAAAGGAAATTTGG - Intergenic
1023317207 7:38951673-38951695 CCTTATAAGAAAAGGAAATGAGG + Intergenic
1023378768 7:39585362-39585384 CCTTATAAGAAGAGGAAATTTGG + Intronic
1023790941 7:43753205-43753227 CCTTACGAGAAGAGGAAAGTTGG - Intergenic
1024022413 7:45384259-45384281 CCTTAAAGGAGAAGGAAATCTGG - Intergenic
1024036819 7:45513777-45513799 CCTTATAGCAAGAGGAAATTAGG + Intergenic
1024281468 7:47722817-47722839 CCTTATAAGAAGAGGAGATTAGG - Intronic
1024472714 7:49779885-49779907 CCTTATAAGAAGAGGAGATGTGG - Intronic
1024542709 7:50492025-50492047 CCTTATAAGAAGAGAAAATTTGG + Intronic
1024801820 7:53087908-53087930 CTTTACATGAAGAGCTATTCAGG - Intergenic
1025702809 7:63835501-63835523 CCTTGTAAGAAGAGGAAATTTGG + Intergenic
1026108903 7:67443052-67443074 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1026154692 7:67816864-67816886 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1026172058 7:67962612-67962634 CCTTGTAAGAAGAGGAAATTTGG + Intergenic
1026538869 7:71262990-71263012 CCTTATGAGAAGAGGAAATTTGG + Intronic
1027381936 7:77620436-77620458 CATTACATGAAGAAGAAAAAAGG - Intronic
1027835205 7:83232876-83232898 CCTCATAAGAAGAGGAAATGTGG + Intergenic
1027946873 7:84758471-84758493 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1027979116 7:85194871-85194893 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1028000623 7:85493507-85493529 CCTTACATGAGGAGGAAATTTGG - Intergenic
1028308132 7:89291951-89291973 CCTTACATGACGAGAAAGACAGG + Intronic
1028809315 7:95066153-95066175 CCTTATAAGAATAGGAAATTTGG + Intronic
1028882028 7:95891085-95891107 CCTTATAGGAAGGGGAAATTAGG + Intronic
1028921000 7:96309951-96309973 CCTTATACGAAGAGGAAATTAGG + Intronic
1029013562 7:97289625-97289647 ATTTACATGAAGAGCAAAACAGG - Intergenic
1029193780 7:98790103-98790125 CCTTCTAAGAAGAGGAAATTTGG - Intergenic
1029519246 7:101049690-101049712 CCTTATAAGAAGGGGAAATTTGG - Intronic
1029986547 7:104928142-104928164 CCTCATAAGAAGAGGAAATTTGG + Intergenic
1032172757 7:129599577-129599599 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1032177998 7:129648690-129648712 CCTTACATGGTGAGGGAGTCAGG - Intronic
1032182347 7:129691186-129691208 TCTTAAAGGAAGAGGAAATCAGG - Intronic
1032508639 7:132454703-132454725 CCTTATAAGAAGAGGAAATTTGG + Intronic
1032751331 7:134844838-134844860 TTTTACAAGAAGAGGAAATTTGG - Intronic
1033983615 7:147196032-147196054 CCTTATAAGAAGGGGAAATTAGG + Intronic
1034016363 7:147591361-147591383 CTTCACAAGAAGAGGAAATGAGG - Intronic
1034258004 7:149734949-149734971 CCTGATATGAAGGGGAAATCTGG - Intergenic
1034472937 7:151265251-151265273 CCTTACAAGAAAGGGAAATTTGG + Intronic
1034696367 7:153057678-153057700 CCTCACCTGGAGAGGAAATGTGG + Intergenic
1034760897 7:153670882-153670904 CCTTATAAGAAGAGGAGATCAGG - Intergenic
1034957114 7:155341847-155341869 CCTTAGAAGAAGAGGAGATAAGG - Intergenic
1035046711 7:155972677-155972699 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1035116769 7:156531471-156531493 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1035700813 8:1638311-1638333 CCTTATAAGAAGAGGAGATGAGG + Intronic
1035778966 8:2212185-2212207 CCTTACACAAAGGGGAAATCTGG + Intergenic
1035780574 8:2224250-2224272 CCTTATATGAAGAGGAGTTTAGG + Intergenic
1036161117 8:6389273-6389295 CCTTCTATGAAGGGGAAATTTGG + Intergenic
1036211287 8:6843168-6843190 CCTTATAAGAAAAGGAAATTTGG + Intergenic
1036504334 8:9341746-9341768 CCTTACGAAAAGAGGAAATTTGG + Intergenic
1036732466 8:11277893-11277915 CCTTATACTAAGAGGAAATTTGG - Intergenic
1036781426 8:11650564-11650586 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1037118201 8:15251495-15251517 GCTTGTAAGAAGAGGAAATCTGG - Intergenic
1037127573 8:15369329-15369351 CGATCCATGAAGAGGAAATTTGG - Intergenic
1037717814 8:21414580-21414602 CTTTACAAGAAGAGGAGAGCAGG - Intergenic
1037983698 8:23273205-23273227 CCATATAAGAAGAGGAAATTTGG + Intronic
1038161458 8:25043290-25043312 TCTTATAAGAAGAGGAAATTTGG - Intergenic
1038340124 8:26679181-26679203 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1038340991 8:26684764-26684786 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1038349255 8:26761506-26761528 CCTTATAAGAAGAAGAAATTGGG + Intronic
1038368291 8:26960663-26960685 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1038486360 8:27937827-27937849 CCTTATAGGAAGAGGAGATAAGG - Intronic
1038558703 8:28549178-28549200 CCTTATAAGAGGAGGAAATTTGG - Intronic
1039139928 8:34375279-34375301 CCTAACATGCAGTGGAAATCAGG - Intergenic
1039146736 8:34455675-34455697 CCTTATAAGAAGAAGAAATATGG + Intergenic
1039370895 8:36982896-36982918 CCTTACAAGAAGAGGGAATTAGG + Intergenic
1039440033 8:37588669-37588691 CCTTATAAGAAGAGGAAATTAGG - Intergenic
1039593819 8:38772612-38772634 CCATGGATGAAGAGGAAACCAGG - Intronic
1039720785 8:40162018-40162040 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1040484526 8:47857480-47857502 CCTTATTAAAAGAGGAAATCAGG + Intronic
1040660168 8:49563829-49563851 CCTTATTAGAAGAGGAAATTAGG - Intergenic
1040803934 8:51373190-51373212 CCTTATAAGAAAAGGAAATGTGG + Intronic
1040856022 8:51948716-51948738 CCTTATAAGAAAAGGAAATTTGG + Intergenic
1040857373 8:51961857-51961879 CCTTACAAGAAGAGGAAATGTGG - Intergenic
1040901253 8:52419252-52419274 CCTTACAAGATGAGAAAATTTGG + Intronic
1041214865 8:55590438-55590460 CCTTAGAAGAAGCGGAAATTGGG + Intergenic
1041240312 8:55843584-55843606 CCTTATAAGGAGAGGAAATTTGG + Intergenic
1041596581 8:59661095-59661117 CCTTACAAGAAGGGAAAATTTGG + Intergenic
1041644249 8:60235303-60235325 CCTTATAAGAAGAGGAAATTTGG - Intronic
1041662198 8:60411414-60411436 CCTTATATGGAGAGGAGATAAGG - Intergenic
1041777069 8:61535037-61535059 CCTTATAAGAAGAGGAACTTTGG - Intronic
1041840361 8:62263344-62263366 TATTAAATGAAGAGGTAATCTGG + Intronic
1041954248 8:63539916-63539938 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1042192218 8:66198509-66198531 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1042250994 8:66756105-66756127 TCTTATAAGAAGAGGAAATTTGG + Intronic
1042929029 8:73995402-73995424 CCTTATAAGAAGAGGAAATTTGG - Intronic
1043208338 8:77476276-77476298 CCTTATAGGAAGAGGAGATTAGG + Intergenic
1043402260 8:79895431-79895453 TCTTACAAGAAGAGGAAATTTGG + Intergenic
1044354741 8:91208041-91208063 CCTTATGAGAAGAGGAAATTTGG - Intronic
1044383044 8:91556069-91556091 CCCAACATGAAGAGAAAATAAGG - Intergenic
1044387068 8:91601788-91601810 CCTTCTATGAAGAGGAGATTGGG - Intergenic
1044700161 8:94958415-94958437 CCTTACGAGAAGAGGAGATTAGG - Intronic
1044704231 8:94993177-94993199 CCTTATAAGAAGAGGAGATAAGG - Intronic
1044739767 8:95314331-95314353 CCTTGCCTCAAAAGGAAATCAGG - Intergenic
1044846338 8:96385535-96385557 CCTTATAAGAAGAGGAAAATAGG + Intergenic
1044871714 8:96626284-96626306 CCTTACTAGAAGAGAAGATCTGG - Intergenic
1045003683 8:97899596-97899618 CCTTATAAGAAGAGGAAGTCTGG - Intronic
1045403491 8:101842155-101842177 CCTTAAAAGAAGAGGAAATTTGG - Intronic
1045611085 8:103842988-103843010 ACTTATAAGAAGAGGAAATTTGG - Intronic
1045660545 8:104433019-104433041 TCTTATACGAAGAGGAAATTTGG + Intronic
1045669277 8:104529180-104529202 CCTTATAAGAAGAGGAGATCAGG + Intronic
1045704704 8:104908277-104908299 CCTTATAAGAAGAGGAAATTAGG + Intronic
1045943244 8:107763987-107764009 TCTTACAAGAAGAGGAAATTTGG + Intergenic
1045943405 8:107765841-107765863 CCTTATAAGATGAGGAAATTTGG + Intergenic
1046490744 8:114950630-114950652 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1046627787 8:116593593-116593615 CCTTATTAGAAGAGGAAATTAGG + Intergenic
1046790542 8:118317031-118317053 TCTTATAAGAAGAGGAAATTTGG + Intronic
1047041005 8:120995620-120995642 CCTTAGGAGAGGAGGAAATCTGG - Intergenic
1047183787 8:122614057-122614079 CCTTTCAAGAAGAGGAAACTTGG - Intergenic
1047184985 8:122624741-122624763 CCTTACAAGAAGAAGAAAAGAGG - Intergenic
1047433752 8:124817027-124817049 CCTTAAATGATGAGGGAATATGG + Intergenic
1047462984 8:125086461-125086483 CTTTGTATGAAGAGGAAATTTGG - Intronic
1048544365 8:135372632-135372654 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1048620390 8:136126491-136126513 CCTTGAATGTAGAGAAAATCAGG + Intergenic
1049930175 9:448690-448712 CCTTACGAGAAGAGGAAATCTGG - Intronic
1050034696 9:1423168-1423190 CCTGACAAGAAGAAGAAATGGGG - Intergenic
1050185230 9:2965949-2965971 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1050347162 9:4702219-4702241 CATTAAAAGGAGAGGAAATCTGG - Intronic
1050369512 9:4906405-4906427 CCTTATAAGAAGAGAAAATGTGG + Intergenic
1050639275 9:7649224-7649246 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1051195970 9:14563327-14563349 CTTTACCTGAATTGGAAATCAGG - Intergenic
1051202429 9:14642597-14642619 CCTTATAAGAAGAGGAAATTTGG + Intronic
1051262979 9:15283505-15283527 CCTGGCATGAAAAGGAACTCAGG - Intronic
1051358232 9:16259395-16259417 CCTTATAACAAGAGGAAATTTGG - Intronic
1051747801 9:20311541-20311563 CCTTACATGAAGGGCAAAGCAGG - Intergenic
1053006092 9:34605610-34605632 CCTTACAAAAAGAAGAAATTTGG + Intergenic
1053529693 9:38868089-38868111 CCTCATAAGAAGGGGAAATCTGG + Intergenic
1053935613 9:43147282-43147304 CCTCACATGAAAAGCAGATCAGG + Intergenic
1054201918 9:62092516-62092538 CCTCATAAGAAGGGGAAATCTGG + Intergenic
1054636439 9:67495843-67495865 CCTCATAAGAAGGGGAAATCTGG - Intergenic
1055367080 9:75556145-75556167 CCTTATATGAAAAGGAAATTAGG + Intergenic
1055478330 9:76685567-76685589 CCTTATAGCAAGAGGAAATTTGG + Intronic
1055645632 9:78358905-78358927 CCTTCTAAGAAGAGGAAATTTGG - Intergenic
1056047854 9:82738052-82738074 CCTTATAAAAACAGGAAATCTGG - Intergenic
1056048248 9:82741407-82741429 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1056296505 9:85198560-85198582 CCTTATAACAAGAGGAAATTAGG - Intergenic
1056399496 9:86212909-86212931 CCTTACAGGATGAGGAATCCAGG + Intergenic
1056923237 9:90810343-90810365 CCTTACATGAAAAGGAGATCTGG - Intronic
1056938986 9:90938925-90938947 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1057007858 9:91576409-91576431 CCTTGTAAGAGGAGGAAATCAGG + Intronic
1057008068 9:91578135-91578157 CCTTATAAGAAGAGGAAATTAGG + Intronic
1057636405 9:96773452-96773474 CCTTACAGGAAAAGAAAATTTGG + Intronic
1058003638 9:99892845-99892867 CCTTATATGAAGAGGAAATTTGG + Intergenic
1058590144 9:106556823-106556845 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1058735519 9:107890521-107890543 CCTTACAAGAAGAGAGAATTTGG + Intergenic
1059343170 9:113611054-113611076 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1059496721 9:114716139-114716161 CCTTGTAAGAAGAGGAAATTTGG - Intergenic
1059498800 9:114732679-114732701 CCTTCTAAGAAGAGGAAATTAGG + Intergenic
1059611129 9:115896978-115897000 CTATAGAGGAAGAGGAAATCAGG + Intergenic
1059698808 9:116755415-116755437 CCTTTTAAGAAGAGGAAAACTGG + Intronic
1059726636 9:117014756-117014778 CCTTATAAGAAGAGGATATTGGG + Intronic
1060241626 9:121908805-121908827 CCTTACAAGGAGAGGAAATTTGG - Intronic
1060407205 9:123378732-123378754 CCTAACATGCAGATGAAAGCTGG + Exonic
1061094678 9:128448789-128448811 CCTTACAAAAAGGGGAAATTTGG + Intergenic
1061277090 9:129575376-129575398 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1061641691 9:131962856-131962878 CCTTTAGTGAAGAGGAAAGCTGG + Intronic
1062150211 9:135014259-135014281 CCTTAAAAGAAGAGGAGATTAGG + Intergenic
1062292117 9:135800460-135800482 CCTTACAAGAAAAGGAAATTAGG + Intergenic
1062488947 9:136795108-136795130 CCTCATAAGAAGAGGAAATTAGG + Intronic
1062593714 9:137287965-137287987 CCTTACAAGAAGAGAATATTTGG + Intergenic
1185606251 X:1368652-1368674 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185682075 X:1897118-1897140 CCTTATAAGAAGAGGACATGAGG - Intergenic
1185704699 X:2258004-2258026 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185721826 X:2388416-2388438 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185776359 X:2805731-2805753 CCTTATAAGAAGAGGAGATGAGG - Intronic
1185790215 X:2923651-2923673 CCTTATAAGAAGAGGAGATGAGG - Intronic
1185791837 X:2933057-2933079 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1185800703 X:3007899-3007921 CTTTATAAGAAGAGGAAATGAGG - Intronic
1185841674 X:3397884-3397906 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1185921971 X:4103482-4103504 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1185943607 X:4349138-4349160 CCTTATAAGAAGAGGAGATTCGG + Intergenic
1186012590 X:5151596-5151618 CCCCAGAAGAAGAGGAAATCTGG + Intergenic
1186186816 X:7028957-7028979 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1186187838 X:7039516-7039538 CCTTACAAGAAGAGGAGATGAGG + Intergenic
1186295953 X:8148658-8148680 CTTTGCATGAAGGGGAAACCAGG + Intergenic
1186371686 X:8953357-8953379 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1186442469 X:9598043-9598065 CCTTAGAAAAAGAGGAAATTTGG + Intronic
1186453202 X:9690454-9690476 CCTTATGAGAAGAGGAGATCAGG - Intronic
1186604147 X:11071306-11071328 GCTTAAATGAAGAGAAAATGAGG - Intergenic
1186652039 X:11571516-11571538 CCTTACATGGGGAGATAATCTGG + Intronic
1186765113 X:12762820-12762842 CCTTACACAAAGAGAAAATTTGG + Intergenic
1187597454 X:20788798-20788820 CCTTATAAGAAGAGGATATTAGG + Intergenic
1188032884 X:25284106-25284128 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1188121069 X:26308587-26308609 CCTTATAGGAAGAGGAAATTTGG - Intergenic
1188384942 X:29544933-29544955 CCTTATAAGAAGATGAAATTAGG + Intronic
1188646685 X:32577142-32577164 CCTTATGAGAAGAGGAAATTTGG + Intronic
1188695823 X:33189526-33189548 CCTGAGATGAAGTGGAAACCAGG + Intronic
1188859434 X:35239289-35239311 CCTTACATGAAGAGGAAACTTGG + Intergenic
1189032208 X:37462244-37462266 TCTTACATGATAAGGAAATGAGG + Intronic
1189108764 X:38265082-38265104 CCTTATAAAAAGAGGAAATGTGG + Intronic
1189211818 X:39290277-39290299 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1189249243 X:39587318-39587340 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1189288470 X:39868517-39868539 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1189297015 X:39926067-39926089 CCTTACGAGAAGAGGAAATTTGG - Intergenic
1189465831 X:41276880-41276902 CCTTAAATCAAAAGGAAAGCGGG + Intergenic
1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG + Exonic
1190253462 X:48745073-48745095 CCTTATAAGGAGAGGAGATCAGG - Intergenic
1190636203 X:52436467-52436489 CCTTATAAGAAGAGGAAATGAGG - Intergenic
1190643611 X:52504370-52504392 CCTTACAAGAAGAGGAAATGAGG - Intergenic
1190792207 X:53710970-53710992 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1192880991 X:75284278-75284300 ATTTACCTGAAGAGGAATTCAGG - Intronic
1192886397 X:75339072-75339094 CCTTATATGAAGAGAAAATTTGG - Intergenic
1192901448 X:75502254-75502276 CCTTATAGGGAAAGGAAATCTGG - Intronic
1193134741 X:77958107-77958129 TCTTACAGGAAGGAGAAATCTGG + Intronic
1193543595 X:82800469-82800491 CCTTATGAGAAGAGGAAATTTGG + Intergenic
1193758120 X:85433753-85433775 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1194213585 X:91099474-91099496 ACTTTCATGAAGAAGAAAGCAGG + Intergenic
1194458318 X:94132492-94132514 CCTTATAAGAAGAGGCAATTAGG + Intergenic
1195746515 X:108124058-108124080 CCTCACAGGCAGAAGAAATCAGG - Intronic
1196114632 X:111985575-111985597 CCTTGAATGAAGGGGAAACCAGG - Intronic
1196654076 X:118198776-118198798 CCTTACAAGAAAAGGAAATGTGG + Intergenic
1196717019 X:118822013-118822035 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1197968131 X:132086537-132086559 CCTTATAAGAAGAAGAAATTTGG + Intronic
1198073367 X:133171164-133171186 CCTTATATGAAGAGGAGATGAGG - Intergenic
1198394915 X:136211098-136211120 CTTTTCCTCAAGAGGAAATCTGG + Exonic
1198403013 X:136285834-136285856 TCTTATATAAAGAGGAAATTTGG - Intergenic
1198512821 X:137371390-137371412 CCTTATAAGAAGAGGAAATGTGG - Intergenic
1198895076 X:141444692-141444714 CCTTTTAAGAAGAGGAAATTAGG - Intergenic
1198959298 X:142167364-142167386 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1199685369 X:150260642-150260664 CCTTATAGAAAGAGGAAATTCGG - Intergenic
1199845758 X:151692173-151692195 CCTTATAAGAAGAGGAAATTAGG - Intergenic
1199848355 X:151707749-151707771 CCTTATAGGAAGAGGAGATTAGG - Intergenic
1199948757 X:152688640-152688662 CCTTATAAGAAGAGGACATTAGG + Intergenic
1199960919 X:152779809-152779831 CCTTATAAGAAGAGGACATTAGG - Intergenic
1200298712 X:154950064-154950086 CCTTATAAGAAGAGGAAATGTGG - Intronic
1200819179 Y:7564508-7564530 TCTTACAAGAAGAGGAGATTTGG - Intergenic
1201147664 Y:11073674-11073696 CCTTACCAGAAGAGGAACTCTGG + Intergenic
1201231370 Y:11867942-11867964 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1201293616 Y:12445744-12445766 CCTTATAAGAAGAGGAGATGAGG + Intergenic