ID: 1138952266

View in Genome Browser
Species Human (GRCh38)
Location 16:61927678-61927700
Sequence GCCATTAGGTGCCACCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138952266_1138952273 5 Left 1138952266 16:61927678-61927700 CCCATCAGGTGGCACCTAATGGC 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1138952273 16:61927706-61927728 CATCGTCAAACTCTGTGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 93
1138952266_1138952275 10 Left 1138952266 16:61927678-61927700 CCCATCAGGTGGCACCTAATGGC 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1138952275 16:61927711-61927733 TCAAACTCTGTGCCAGGGGCAGG 0: 1
1: 0
2: 3
3: 38
4: 382
1138952266_1138952274 6 Left 1138952266 16:61927678-61927700 CCCATCAGGTGGCACCTAATGGC 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1138952274 16:61927707-61927729 ATCGTCAAACTCTGTGCCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 90
1138952266_1138952272 4 Left 1138952266 16:61927678-61927700 CCCATCAGGTGGCACCTAATGGC 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1138952272 16:61927705-61927727 GCATCGTCAAACTCTGTGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138952266 Original CRISPR GCCATTAGGTGCCACCTGAT GGG (reversed) Intronic
904886457 1:33742256-33742278 GACATTAGATGCTACCTGGTGGG - Intronic
907429088 1:54400867-54400889 GTCATTGGGTCCCACCTGCTTGG - Intronic
912962544 1:114208830-114208852 GCCCTGAGGTGCAGCCTGATTGG - Intergenic
914704109 1:150157460-150157482 GCCATTAGGTGTCCCCTTGTTGG - Exonic
915837467 1:159188910-159188932 GGCGTTAGGAGCCACCTTATAGG + Intronic
920167080 1:204043666-204043688 GCCCTTAGGTGCCAACCCATGGG + Intergenic
1074590501 10:114808321-114808343 GAAAATAGGTGCCACCTGATGGG + Intergenic
1074694857 10:116041133-116041155 AACATTGGGTGTCACCTGATGGG - Intergenic
1075806885 10:125195584-125195606 GCCAGTGGGTGGGACCTGATAGG + Intergenic
1086290068 11:85298433-85298455 CTAATTACGTGCCACCTGATAGG + Intronic
1091403679 12:196143-196165 GCCGTCATGTGCTACCTGATAGG - Exonic
1091820504 12:3472114-3472136 GACATTGGCTGCAACCTGATGGG - Intronic
1092812224 12:12282193-12282215 GAAATTATGTGCTACCTGATAGG + Intergenic
1095848095 12:46769088-46769110 GACATTGGGAGCCACCTTATAGG - Intronic
1097983565 12:65758908-65758930 TCAATTTGGTGCCACCTAATTGG + Intergenic
1102873656 12:116433214-116433236 GGCAGTATGTGCCAGCTGATAGG + Intergenic
1106832478 13:33600043-33600065 GACTTTATTTGCCACCTGATGGG + Intergenic
1108196281 13:47999113-47999135 GTCACTAGGTGGCACCTAATTGG + Intronic
1109052798 13:57506436-57506458 GGCAATAGGTGCTAGCTGATGGG - Intergenic
1111714530 13:91863216-91863238 GAAATTATGTACCACCTGATAGG - Intronic
1113859191 13:113470372-113470394 GCCATTATGTGACACATGATGGG + Intronic
1114764612 14:25356675-25356697 GCCATTTTGTCCCACCTAATGGG + Intergenic
1116452508 14:45081381-45081403 GCCAGTAGTGGCAACCTGATTGG + Intergenic
1118113239 14:62746516-62746538 GCCCTAAAGTGCCCCCTGATTGG - Intronic
1118299649 14:64603801-64603823 GGCATCAGGTGCCCCCTGATGGG + Intergenic
1119433336 14:74582598-74582620 GCCAATAGTGTCCACCTGATAGG - Intronic
1123936543 15:25196810-25196832 GACATTATGTGGCCCCTGATTGG + Intergenic
1124391692 15:29264486-29264508 GAAATTTTGTGCCACCTGATAGG + Intronic
1131615623 15:94014461-94014483 CCCATTAGATGCCAACAGATCGG + Intergenic
1133709623 16:8388916-8388938 GTCATTAGGTCCCTCATGATTGG + Intergenic
1138952266 16:61927678-61927700 GCCATTAGGTGCCACCTGATGGG - Intronic
1141818304 16:86427948-86427970 GCGATTAGGTTCCACTTCATGGG + Intergenic
1142261862 16:89046662-89046684 GCCTTATGGTGCAACCTGATAGG + Intergenic
1149525156 17:57350013-57350035 ACCAGTAGGTGTCATCTGATGGG + Intronic
1150132802 17:62678436-62678458 GGCAGTAGGTGCCCCCTGAGGGG + Intronic
1155290539 18:24337042-24337064 GACATTATGTGCCTCCTAATAGG + Intronic
1157562990 18:48661658-48661680 AACATTAGGGGCCACCTGCTTGG + Intronic
1158544512 18:58384733-58384755 CCCAGGAGGTGCCACCTGAGAGG + Intronic
1159047243 18:63381089-63381111 GACATCATGTGCCACCTGGTAGG - Intergenic
1159853514 18:73556761-73556783 GCCATCACGTCCCACCTGAGAGG - Intergenic
925050715 2:813084-813106 ACTCTTAGGAGCCACCTGATAGG - Intergenic
925928850 2:8691457-8691479 GCCATGAGGTGCCTCCCGATGGG + Intergenic
927189771 2:20509636-20509658 GGCATTTGCTGCCACTTGATAGG - Intergenic
927412777 2:22845605-22845627 GCTTTTATGTGCCACCTGCTAGG - Intergenic
931585919 2:63827915-63827937 GCCATTAGGTCATACCTGCTTGG - Intergenic
935416948 2:102829164-102829186 GCAAAAAGGTGCTACCTGATTGG - Intronic
935509408 2:103952435-103952457 GAAATTGGGTGCCACCTGATTGG + Intergenic
942492721 2:176506092-176506114 GCCATGATGTACCCCCTGATCGG - Intergenic
945319189 2:208401997-208402019 GCCATTTGGTGGCACATGACTGG + Intronic
948123235 2:235546273-235546295 GCCCTCGGGTGCCACCTGATGGG + Intronic
1168851465 20:979893-979915 GCCATTTATTCCCACCTGATAGG + Intronic
1177456045 21:21341467-21341489 CCAATTAGTTGACACCTGATGGG + Intronic
1179405326 21:41121177-41121199 GCCATGAGGTGCCCTCTGAGGGG - Intergenic
1181910110 22:26231849-26231871 GCCCTTAGCTGTCACCTGAGTGG + Intronic
951849963 3:27128337-27128359 GGCATTATATGCCACCTGATGGG - Intronic
956226110 3:66960862-66960884 GAAATCATGTGCCACCTGATTGG - Intergenic
956608811 3:71101036-71101058 CCCTTCAGGTGCCACCTGCTGGG - Intronic
961943919 3:130665935-130665957 GGCATTATGTGCCTCCTGAGGGG + Intronic
963064182 3:141250473-141250495 GCCAGGAGGTGCATCCTGATTGG + Intronic
963337093 3:143987854-143987876 GCCATTAGCAACCACCTAATTGG + Intronic
967129150 3:186454516-186454538 GGCACTGTGTGCCACCTGATAGG - Intergenic
975349050 4:73326040-73326062 GCCAGCAGCTGCAACCTGATGGG + Intergenic
975767339 4:77682713-77682735 TCCAATAGTTGCCACTTGATTGG + Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
978177025 4:105744256-105744278 GACATAATGTGCCTCCTGATAGG - Intronic
978638894 4:110844768-110844790 GCCCTTAGGTGACTGCTGATGGG - Intergenic
979367179 4:119839491-119839513 GCCATTAGGTGCCACAAATTGGG + Intergenic
982443725 4:155465773-155465795 CCCATTTCGTGCCACCTCATGGG + Intergenic
985662250 5:1163140-1163162 GCCCTTAGCTGCCTCCTGACAGG - Intergenic
994535836 5:101027960-101027982 GCCACTTGGTGCCTTCTGATTGG - Intergenic
1001886490 5:175295295-175295317 GCCACTCTGTGCCTCCTGATTGG - Intergenic
1009850018 6:69184236-69184258 GACATTAGAAGCCAGCTGATGGG - Intronic
1016469713 6:144362274-144362296 GTCACTGGGTGCCACCGGATGGG - Intronic
1016653164 6:146486150-146486172 GGCATTATGTACCACCTGATAGG - Intergenic
1018728546 6:166631860-166631882 GCCCTGAGGTGCCACCTGTCTGG - Intronic
1020906110 7:14066403-14066425 GCTATAAGGTGGGACCTGATTGG + Intergenic
1021897859 7:25254235-25254257 GAAATTTTGTGCCACCTGATAGG + Intergenic
1023756805 7:43426122-43426144 GTCATTAAGTGCCCCATGATTGG - Intronic
1026077343 7:67184431-67184453 GACATTATGTGACTCCTGATTGG - Intronic
1026699525 7:72627675-72627697 GACATTATGTGACTCCTGATTGG + Intronic
1029648202 7:101871633-101871655 TCTACTAGATGCCACCTGATGGG - Intronic
1032554411 7:132816747-132816769 GCTATTAGATGCAACCTGCTTGG + Intronic
1033974201 7:147079690-147079712 GCCACTTTGTGCTACCTGATAGG + Intronic
1037099826 8:15031552-15031574 GCCATTAGTTTCCACCTCACAGG - Intronic
1038450731 8:27637360-27637382 GCCATTAGCAGCCACCTGTGGGG + Intronic
1050907777 9:11027176-11027198 TCCATTAGGTGGTACCTGACTGG + Intergenic
1058450299 9:105090234-105090256 GCGATTGGGTTGCACCTGATTGG - Intergenic
1187486898 X:19712765-19712787 GACATCACGTGCCTCCTGATAGG + Intronic
1189844314 X:45118856-45118878 GACATAATGTGCCTCCTGATGGG - Intergenic
1191586519 X:62833284-62833306 CCCATTAGGTCCCACCTAATTGG + Intergenic
1196636122 X:118004813-118004835 AATATCAGGTGCCACCTGATAGG + Intronic
1198522523 X:137467499-137467521 GAAATCATGTGCCACCTGATAGG - Intergenic