ID: 1138953078

View in Genome Browser
Species Human (GRCh38)
Location 16:61937677-61937699
Sequence CTAGTATCACATATCTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138953076_1138953078 0 Left 1138953076 16:61937654-61937676 CCCAACTTTTAGTTACAATAGAG 0: 1
1: 0
2: 0
3: 17
4: 156
Right 1138953078 16:61937677-61937699 CTAGTATCACATATCTATAAAGG 0: 1
1: 0
2: 0
3: 2
4: 140
1138953077_1138953078 -1 Left 1138953077 16:61937655-61937677 CCAACTTTTAGTTACAATAGAGC 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1138953078 16:61937677-61937699 CTAGTATCACATATCTATAAAGG 0: 1
1: 0
2: 0
3: 2
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138953078 Original CRISPR CTAGTATCACATATCTATAA AGG Intronic
901099612 1:6709273-6709295 CTAGAACCAAAGATCTATAAAGG - Intergenic
901706214 1:11075325-11075347 TTAGTATTACATATCTTTATAGG + Intronic
903725289 1:25438065-25438087 GTAGTATAACATTTTTATAAAGG + Intronic
905523779 1:38621268-38621290 CTCATATCACATATGTGTAAAGG - Intergenic
906610431 1:47198186-47198208 CTAGAATGTCATTTCTATAAAGG - Intergenic
907221628 1:52911391-52911413 CTAGGATCACATAGCTAGTAAGG - Intronic
907753423 1:57285634-57285656 CTGGTTTCACTTATCTTTAAAGG - Intronic
907920833 1:58910301-58910323 CTAATATCACCTATCTCTTAGGG - Intergenic
911299547 1:96155878-96155900 CTTGTATCAAATATTTTTAAAGG - Intergenic
912108392 1:106309812-106309834 CTGGTATCACAGAAATATAAGGG + Intergenic
918912156 1:190589090-190589112 CTATTCTCACATCGCTATAAAGG + Intergenic
919057880 1:192593306-192593328 CTAGAATGTCATATCTAGAAAGG + Intergenic
919656745 1:200204052-200204074 TATGTATTACATATCTATAATGG + Intergenic
921322063 1:213951586-213951608 CTGGTTTCACATATATATCATGG + Intergenic
1063076596 10:2722937-2722959 CTCTTAACACATATCTATAAGGG + Intergenic
1063743222 10:8849474-8849496 CTTCTTTCACATATGTATAAGGG + Intergenic
1065272371 10:24048204-24048226 CATGTATTACATATCTATATGGG + Intronic
1065946497 10:30609702-30609724 CTACTTCCAAATATCTATAAAGG + Intergenic
1067809192 10:49413999-49414021 CTAGGAACTCAAATCTATAATGG - Intergenic
1069182709 10:65383048-65383070 CTACTGTCACATATGTAAAACGG + Intergenic
1071884952 10:89939654-89939676 CTAGTCTTACATTGCTATAAAGG - Intergenic
1072200064 10:93150241-93150263 CTAGAATGACATTTCTAGAATGG - Intergenic
1072541568 10:96402300-96402322 CTAGTACCACAAATGTAGAAAGG - Intronic
1078346369 11:10553267-10553289 CTAATATCAGATATTAATAACGG + Intergenic
1079770781 11:24456258-24456280 CTAGTATCTAATATATTTAAAGG - Intergenic
1081229616 11:40568703-40568725 CTGGAATCACATACCTAGAATGG + Intronic
1083495577 11:63049401-63049423 CTAATATCCATTATCTATAAGGG - Intergenic
1094777827 12:33752139-33752161 ATAGTATCAAATAGGTATAAAGG + Intergenic
1098725774 12:73964565-73964587 CCACCATCAGATATCTATAATGG + Intergenic
1100041155 12:90319125-90319147 ATATTTTCATATATCTATAATGG + Intergenic
1104499635 12:129272660-129272682 CTAATATCTAAAATCTATAAGGG - Intronic
1105807236 13:23960877-23960899 CTAGCATCAAATATTTTTAAAGG + Intergenic
1109214176 13:59568835-59568857 CTAATATCACAGTTCTATAGGGG - Intergenic
1109643226 13:65219448-65219470 CATGTATCACATATATATTATGG + Intergenic
1113162666 13:107399792-107399814 CTTGTATCACATGTTTGTAAAGG - Intronic
1118147386 14:63154810-63154832 CTTGTAAAACATATCTATGAAGG - Intergenic
1123218350 14:106832846-106832868 CTAATATAACATATGTATATAGG + Intergenic
1123702895 15:22928732-22928754 CTAATATCACATCTATAAAAAGG - Intronic
1125436917 15:39655967-39655989 ATAGAATCACATAACTAGAATGG + Intronic
1127597334 15:60498835-60498857 CTGGTCTAACATAGCTATAAAGG + Intronic
1128852837 15:70978137-70978159 CTAATATAACATATATATACTGG + Intronic
1135790677 16:25391716-25391738 GTAGTGTCATATATTTATAAGGG + Intergenic
1135837770 16:25842724-25842746 ATAGGATCAGATACCTATAAAGG - Intronic
1138360096 16:56421083-56421105 CTATTTTCACATAATTATAATGG + Intronic
1138906238 16:61338363-61338385 CTAATATCCAAAATCTATAAGGG + Intergenic
1138953078 16:61937677-61937699 CTAGTATCACATATCTATAAAGG + Intronic
1145963338 17:28900418-28900440 CAAGGAAGACATATCTATAAAGG - Intronic
1146709105 17:35025441-35025463 CTAGTTTCTCATATGTAAAATGG + Intronic
1149465094 17:56872228-56872250 CTTGTATGACAAATATATAAAGG - Intergenic
1153193263 18:2566131-2566153 CTGATATCAGATATCTAAAATGG + Intronic
1155559800 18:27063271-27063293 CCAGTATCACAAATATATGAGGG - Intronic
1162653033 19:12105709-12105731 CTACTATAAAATATGTATAAAGG - Intronic
1163055733 19:14716189-14716211 CCAGCATCACATCTCTATACAGG - Exonic
925983468 2:9195752-9195774 GTACTATCACATATCTAGCAGGG - Intergenic
927284866 2:21346205-21346227 TTAGTATCACATCTTTTTAATGG - Intergenic
929319483 2:40525468-40525490 ATAGTTCCACATATCCATAAGGG + Intronic
933287769 2:80402651-80402673 CTAGTACCCCTTATCTACAAGGG + Intronic
935429497 2:102959842-102959864 CTATTATCCCATTTATATAAAGG - Intergenic
936562138 2:113549240-113549262 CTAATATCTCATCTCTAGAAGGG + Intergenic
938591344 2:132739242-132739264 CCAATTTCACATATCTGTAATGG + Intronic
940690128 2:156906416-156906438 AAAGTATCACATCTCTTTAAAGG - Intergenic
941558969 2:167020655-167020677 ATAGTTTCAAATATCTATACTGG + Intronic
942198740 2:173549711-173549733 CTATTATCACATTTATACAAAGG + Intergenic
944026475 2:195175648-195175670 CTAGTATCAAAAATATAAAAAGG + Intergenic
944360930 2:198855609-198855631 CTAATATCCAGTATCTATAAGGG + Intergenic
945627314 2:212226659-212226681 CTAATATGACATATCTCTGAGGG - Intronic
1170321792 20:15108119-15108141 CCAGTATCACATAGCTAAGAAGG - Intronic
1171055049 20:21898472-21898494 GTAGTATAACATTTCTCTAAAGG - Intergenic
1171748862 20:29027638-29027660 CAACTATCACACATCCATAAGGG - Intergenic
1176316261 21:5247487-5247509 CAACTATCACACATCCATAAGGG + Intergenic
1178415262 21:32399735-32399757 CACATATCACATTTCTATAATGG - Intergenic
1179262282 21:39768406-39768428 CTAGTATCACTTTTGTATAAAGG + Intronic
1180863684 22:19103169-19103191 TTAGTATGAAATATCTAGAATGG + Intronic
1183291733 22:37006503-37006525 TTAGTTTCACAGATCTATGATGG + Intronic
951093871 3:18605869-18605891 ATAGTCTTACTTATCTATAAAGG + Intergenic
952021490 3:29026765-29026787 CTAGTATCTAAAATGTATAAAGG + Intergenic
952633442 3:35498135-35498157 AAGGTATGACATATCTATAATGG - Intergenic
957379967 3:79414736-79414758 CCAGTTTCCCATATTTATAATGG - Intronic
959464787 3:106671759-106671781 CTAATATCACACAAATATAAAGG + Intergenic
960856908 3:122111241-122111263 CAAATATATCATATCTATAATGG - Intronic
963006402 3:140729844-140729866 CTAGTCTCACAGATCCATGATGG - Intergenic
963088385 3:141459446-141459468 CTATCCTGACATATCTATAATGG - Intergenic
964897439 3:161614611-161614633 CTAGTCTCACACATTCATAAGGG - Intergenic
964946929 3:162236569-162236591 AAAGTATCTTATATCTATAAAGG - Intergenic
965765550 3:172126483-172126505 CTAGTAACTCAAATCTAGAAAGG + Intronic
966109744 3:176385035-176385057 CCAGTATCACATATTTTAAAAGG + Intergenic
966636206 3:182136553-182136575 CTAATATAACATATACATAAAGG - Intergenic
968683174 4:1935951-1935973 CATGTAACACATATCTCTAATGG - Intronic
968865191 4:3205117-3205139 CTAGCATCACATATTTACCATGG + Intronic
972874109 4:43337475-43337497 CTTGTATCACATTTTAATAAGGG + Intergenic
972900408 4:43674783-43674805 CTAATATCAATAATCTATAAGGG - Intergenic
972950793 4:44319868-44319890 CTAGAATCTCAGTTCTATAATGG - Intronic
974450080 4:62043218-62043240 CTAGTTTAACATCTCCATAAGGG + Intronic
979797067 4:124859033-124859055 CTAGTGTCACTGAACTATAAAGG - Intergenic
984446121 4:179837870-179837892 GTAGTAGCACATATTTTTAAGGG + Intergenic
985430588 4:189875845-189875867 CAACTATCACACATCCATAAGGG - Intergenic
988324867 5:29751034-29751056 TTAATATCACATATATTTAATGG - Intergenic
988637538 5:33002382-33002404 CGAGTAGCTCATATCTATTAAGG - Intergenic
995415271 5:111904283-111904305 ATAATGTCACATATCTATCATGG + Intronic
997871497 5:137509414-137509436 ATAATAGCACATATCTATCAGGG + Intronic
1004922776 6:20392475-20392497 CTAGTCTCTCAATTCTATAAAGG - Intergenic
1008181731 6:48339390-48339412 CTAGTACTACTAATCTATAAAGG - Intergenic
1008358183 6:50580900-50580922 CTAGTAGAAGATATCCATAAAGG - Intergenic
1009878062 6:69531147-69531169 CAAGTACCACATAAATATAAGGG + Intergenic
1011140170 6:84145536-84145558 CTAGAATCTGATATCTACAAGGG - Intronic
1011438916 6:87367535-87367557 ATAGTATCTAAGATCTATAAAGG - Intronic
1012733132 6:102906988-102907010 CAAATATCACGTCTCTATAATGG + Intergenic
1013446165 6:110229945-110229967 CTGAAATCACATAACTATAATGG - Exonic
1013848785 6:114488087-114488109 CTAGTATCATTTATCAATGATGG + Intergenic
1014248506 6:119092933-119092955 CTATTATCACAAATCTCTAGGGG + Intronic
1014950263 6:127546061-127546083 CTCCTATCACATATCTGCAATGG + Intronic
1017346546 6:153390025-153390047 CTCAAATCACATATCTAGAAAGG - Intergenic
1018126470 6:160687524-160687546 ATAGTTTCAAATATCTAAAAGGG + Intergenic
1020605684 7:10333822-10333844 CTAGTATGAGATCTCTTTAAAGG + Intergenic
1021347934 7:19550410-19550432 GAAGGATCACATATCTTTAAAGG + Intergenic
1023730173 7:43184403-43184425 ATAGTATCACAGCTATATAATGG - Intronic
1027580238 7:79984126-79984148 TTATTATCATGTATCTATAATGG - Intergenic
1029359072 7:100075162-100075184 CCAGCATCACATCTCTATAGAGG + Exonic
1031764247 7:125756879-125756901 CTAATATCACAGAAATATAAAGG - Intergenic
1033915631 7:146321827-146321849 CTAGTTTAAAATATCTAGAATGG + Intronic
1044015700 8:87046876-87046898 CTAGTATCAAATATCTTACAGGG + Intronic
1045682186 8:104674115-104674137 CTAATATTACATAGCTAGAATGG - Intronic
1046126674 8:109918613-109918635 CCAGTATCATTTATTTATAAGGG + Intergenic
1046264138 8:111809066-111809088 ATTGTATCACACATTTATAAAGG + Intergenic
1047691664 8:127361287-127361309 CTTTTATGACATGTCTATAATGG - Intergenic
1048198907 8:132355259-132355281 CAAGGATCACATATCTAGTAGGG + Intronic
1049890540 9:66087-66109 CTAATATCTCATCTCTAGAAGGG - Intergenic
1052223298 9:26054085-26054107 CTTATATCACATATTTATCAAGG + Intergenic
1052540283 9:29802779-29802801 ATAGATACACATATCTATAAAGG + Intergenic
1053137325 9:35659280-35659302 CTAGTTTCATATATCTAAACTGG - Intronic
1053719888 9:40934748-40934770 CAACTATCACACATCCATAAGGG - Intergenic
1053732006 9:41067270-41067292 CTAATATCTCATCTCTAGAAGGG - Intergenic
1054696448 9:68364448-68364470 CTAATATCTCATCTCTAGAAGGG + Intronic
1056106328 9:83350286-83350308 TTAGTATTATCTATCTATAAAGG + Intronic
1056207646 9:84335754-84335776 CTAATATTATATATGTATAATGG - Intronic
1058201064 9:102041125-102041147 CTAGTATCCAGAATCTATAAGGG - Intergenic
1203455119 Un_GL000219v1:159821-159843 CAACTATCACACATCCATAAAGG + Intergenic
1185965605 X:4598004-4598026 CTACTTTAACATATGTATAATGG + Intergenic
1186916498 X:14228271-14228293 CTAGAAGCACAAATATATAAAGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1195519485 X:105814580-105814602 CTATTTTCACATATTTTTAATGG - Intergenic
1196624717 X:117865075-117865097 ATACTATGACATATCTACAAAGG - Intergenic
1196917042 X:120548021-120548043 CTAGTAGGAGATATATATAAAGG - Intronic