ID: 1138953995

View in Genome Browser
Species Human (GRCh38)
Location 16:61949221-61949243
Sequence AGAAGGCAGCTGGACTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1119
Summary {0: 1, 1: 7, 2: 405, 3: 323, 4: 383}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138953989_1138953995 4 Left 1138953989 16:61949194-61949216 CCCCTGACTCTTTGGAGTTGGGA 0: 7
1: 34
2: 58
3: 76
4: 247
Right 1138953995 16:61949221-61949243 AGAAGGCAGCTGGACTTCCTGGG 0: 1
1: 7
2: 405
3: 323
4: 383
1138953991_1138953995 2 Left 1138953991 16:61949196-61949218 CCTGACTCTTTGGAGTTGGGAGC 0: 20
1: 51
2: 81
3: 61
4: 165
Right 1138953995 16:61949221-61949243 AGAAGGCAGCTGGACTTCCTGGG 0: 1
1: 7
2: 405
3: 323
4: 383
1138953990_1138953995 3 Left 1138953990 16:61949195-61949217 CCCTGACTCTTTGGAGTTGGGAG 0: 12
1: 40
2: 57
3: 90
4: 220
Right 1138953995 16:61949221-61949243 AGAAGGCAGCTGGACTTCCTGGG 0: 1
1: 7
2: 405
3: 323
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138953995 Original CRISPR AGAAGGCAGCTGGACTTCCT GGG Intronic
900127514 1:1075172-1075194 AGCTGGCAGCTGGACAGCCTGGG - Intergenic
900862166 1:5241535-5241557 TGCAGGCAGCTGGAGTTGCTGGG - Intergenic
901034845 1:6330299-6330321 GGAAGGAAGCTGTACTTTCTGGG + Intronic
901093830 1:6662471-6662493 TGAAGCCAGCTGGACTTCCTGGG + Intronic
901414279 1:9106046-9106068 AGAGGGCTGCAGGACTTGCTGGG - Intronic
901570476 1:10156048-10156070 AGAAGGCAGCAAGAATACCTGGG + Intronic
901877383 1:12174711-12174733 GGAGGGCAGCTGGCCCTCCTGGG - Intronic
901879256 1:12184605-12184627 GGCAGGCAGCTGGACTCCCATGG - Intronic
902300524 1:15499330-15499352 AGAAAGCTGCAGGACATCCTAGG + Intronic
903175076 1:21575818-21575840 GGCAGGCAGCTTGACCTCCTCGG + Exonic
903688020 1:25146732-25146754 GGGAGGCAGCCGGACCTCCTGGG - Intergenic
903740513 1:25556049-25556071 AGCAGGAAGCTGGACCCCCTGGG + Intronic
903802605 1:25980782-25980804 CCAAGGCAGGTGGACTGCCTGGG + Intronic
904362127 1:29983023-29983045 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
905167318 1:36090428-36090450 AGAAAGCAGCAGGACTGACTTGG + Intronic
905380201 1:37556589-37556611 GGAAGTCATCTGGAGTTCCTAGG - Intergenic
905399385 1:37690889-37690911 AAAATGCAGGTGGACGTCCTAGG + Intronic
905422891 1:37860162-37860184 AGAAGGGAGCTGGGGGTCCTAGG - Intergenic
905490606 1:38340632-38340654 AGAAGGCAGCTGGCCTTGTAAGG + Intergenic
905593501 1:39185758-39185780 AGAAGGGTGCTGGACTTTCCGGG + Intronic
905642657 1:39601981-39602003 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
906316752 1:44791460-44791482 TGCAGCCAGCTGGTCTTCCTGGG - Intergenic
906517676 1:46449053-46449075 GGGAGGAAGCAGGACTTCCTGGG - Intergenic
906766042 1:48435209-48435231 TGAAGCCAGCTGGACTCCCTGGG + Intronic
906767177 1:48444102-48444124 TGAAGCCAGCTGGATTTCCTGGG + Intronic
906854680 1:49292013-49292035 AGAGGGCAGGGGGCCTTCCTGGG - Intronic
906891503 1:49720966-49720988 CGAAGCCAGCTGGACTTCCTGGG + Intronic
906988901 1:50716446-50716468 TGAAGCCAGCTGGACTTCCTGGG + Intronic
907793444 1:57691098-57691120 TGAAGCCAGCTGGATTTCCTGGG + Intronic
907793721 1:57693292-57693314 TGAAGCCAGCTGGCCTTACTGGG + Intronic
908658893 1:66417509-66417531 TAAAGCCAGCTGGACTTCTTGGG - Intergenic
908848313 1:68347648-68347670 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
909358980 1:74740888-74740910 TGAAGCCAGCTGGACTTTCTGGG - Intronic
909359658 1:74745615-74745637 TGAGGCCAGCTGGACTTCCTGGG - Intronic
909446971 1:75758514-75758536 TGAAGCCAGCTGGACTTCCTGGG + Intronic
909747211 1:79112719-79112741 TGAGGCCAGCTGGACTTTCTGGG + Intergenic
909859202 1:80583485-80583507 TGAAGCCGGCTGTACTTCCTGGG + Intergenic
910043602 1:82884919-82884941 TGAAGCCAGCTAGACTTCCTGGG - Intergenic
910380467 1:86621612-86621634 AGGTGCCAGCTGGGCTTCCTGGG + Intergenic
910435241 1:87199614-87199636 AGAAGGCAGCTCCATTTCCTTGG + Intergenic
910459212 1:87430884-87430906 AGGTGGCAGCTGGACTTCCTGGG + Intergenic
910595313 1:88974608-88974630 TGAAGCCAGGTGGACTTCCTGGG + Intronic
911129206 1:94372289-94372311 TGAAGCCAGCGGAACTTCCTAGG - Intergenic
911130135 1:94378756-94378778 TGAAGCCAGTTGGACTTCCCAGG - Intergenic
911247859 1:95538646-95538668 TGAAGCCAGCTGGACTTTCTGGG - Intergenic
911298586 1:96147678-96147700 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
911299315 1:96153003-96153025 TGAAGCCAGTTGGACTTTCTGGG + Intergenic
911345378 1:96690693-96690715 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
911379618 1:97096491-97096513 TGAAGCCAGCTGGACTTCCTGGG + Intronic
911751077 1:101498988-101499010 TGATGCCAGCTGGACTTCCTGGG + Intergenic
911845218 1:102744582-102744604 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
912021830 1:105115393-105115415 TGAAGCCAGCTGGATTTCCTGGG + Intergenic
912082834 1:105958586-105958608 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
912675921 1:111680565-111680587 TGAAGCCAGCTGGACTTCCTGGG - Intronic
912698323 1:111857607-111857629 AGAAGACAGCTGGAGTCCCCTGG - Intronic
913056338 1:115164731-115164753 ACATGGCAGCTGGACTTCCCTGG + Intergenic
913070226 1:115291995-115292017 AGGAGGAGGCTGGATTTCCTTGG - Intronic
913097067 1:115528647-115528669 AGGGGCCAGCTGGGCTTCCTGGG - Intergenic
913279542 1:117172725-117172747 TGAAGCCAGCTGGACTTCCTAGG + Intronic
913297693 1:117337587-117337609 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
913378923 1:118186806-118186828 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
913383325 1:118232880-118232902 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
913419316 1:118647686-118647708 TGAAGCCAACTGGACTTCCTGGG + Intergenic
914793449 1:150899832-150899854 TGAAGCTATCTGGACTTCCTGGG + Intergenic
915045588 1:153011728-153011750 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
915441946 1:155950941-155950963 CGAAGGCAGCTGGCCGCCCTGGG - Exonic
915762314 1:158327305-158327327 TGAAGCCAGCTGCACTCCCTGGG - Intergenic
916365740 1:164025407-164025429 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
916475559 1:165165338-165165360 AGAGGTCAGCTGGGCATCCTAGG + Intergenic
917025709 1:170639189-170639211 TAAAGCCAGCTGGACTTCCTGGG + Intergenic
917085783 1:171304890-171304912 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
917086875 1:171312410-171312432 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
917279523 1:173367870-173367892 TGAAGCCAGCTGGACTTGCTGGG + Intergenic
917280637 1:173375430-173375452 TGAAGCCAGCTGGATTTCCTGGG + Intergenic
917675900 1:177319386-177319408 TAAAGCCAGCTGGACTTCCTGGG + Intergenic
917676720 1:177325460-177325482 TAAAGCCAGCTGGACTTCCTGGG + Intergenic
917840771 1:178975545-178975567 TAAAGCCAGCTGGACTTCCTGGG + Intergenic
918024099 1:180726016-180726038 TGAAGCCAGCTGGACTTCCTGGG + Intronic
918083293 1:181223809-181223831 AGAAGGCCTCTGGGATTCCTGGG + Intergenic
918764271 1:188458502-188458524 AGGAGGCAGGTGCTCTTCCTGGG - Intergenic
918842557 1:189560939-189560961 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
918939962 1:190980645-190980667 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
919178348 1:194048632-194048654 AAAAGGAAACTGGACTTTCTAGG + Intergenic
919205956 1:194422148-194422170 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
919220162 1:194617792-194617814 TGAAGCCAGCTGGACTTTCTGGG + Intergenic
919257369 1:195141555-195141577 TGAAGCCAACTGGACTTCCTGGG + Intergenic
919355990 1:196522584-196522606 TGAAGCCAGCGGGACTTCCTGGG + Intronic
919397551 1:197069624-197069646 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
919506457 1:198404675-198404697 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
919515348 1:198515306-198515328 AGTTGGCAGCTGTACATCCTGGG + Intergenic
919558436 1:199091121-199091143 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
919559321 1:199097467-199097489 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
920070641 1:203300572-203300594 AAGAGGCAGCTGGTCTTCCCCGG + Intergenic
920486789 1:206378559-206378581 TGAAGCCAGCTGGACTTCCTCGG + Intronic
921034113 1:211359837-211359859 AGAAGTCAGCTGGAAGGCCTAGG - Intronic
921354803 1:214276017-214276039 TGAAGCTAGCTGGACTTCCTGGG - Intergenic
921403529 1:214753453-214753475 AGTAGGAAGCTGGTCTTCCCTGG - Intergenic
921718773 1:218447818-218447840 AGGGGGTTGCTGGACTTCCTTGG - Intergenic
921915153 1:220600686-220600708 AGAAGGCAGCTGAAATTATTTGG + Intronic
921938673 1:220817686-220817708 TGAAGCCAGCTGGACTTCCTGGG - Exonic
922811854 1:228420546-228420568 AGAAAGCAACTGGAATACCTAGG + Intergenic
924505781 1:244682375-244682397 TGAAGCCAGCTGGACTTCCTGGG - Intronic
924647650 1:245894061-245894083 TGAAGCCAGCTGGACTTCCAGGG + Intronic
924865718 1:247978024-247978046 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1063357065 10:5411099-5411121 TGAAGCCAGCTAGACTTCCTGGG - Intergenic
1063414617 10:5863349-5863371 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1063859441 10:10291774-10291796 TGGAGCCAGCTGGACTCCCTGGG - Intergenic
1063972901 10:11393738-11393760 AGCGGGCAGCTGGGCTTCCTGGG + Intergenic
1064219431 10:13427980-13428002 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1064588647 10:16865510-16865532 TGAAGCCAGTTGGACTTCCTGGG + Intronic
1064601854 10:17001559-17001581 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1064665614 10:17648162-17648184 TGAAACTAGCTGGACTTCCTGGG + Intronic
1064757717 10:18586986-18587008 TGAAGCCAACTGGACTTCCTGGG - Intronic
1065082067 10:22138864-22138886 TGAAGTCAGCTGGACTTCCGGGG + Intergenic
1065295067 10:24266468-24266490 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1065422874 10:25566421-25566443 AGGGGCCAGCTGGGCTTCCTGGG - Intronic
1065709361 10:28500653-28500675 AGATGCTAGCTGGGCTTCCTGGG - Intergenic
1065760978 10:28983181-28983203 GCAAGGCTGCTGGAATTCCTTGG + Intergenic
1065862905 10:29886464-29886486 GGAATGCAGCTGGCCTTGCTCGG + Intergenic
1066149602 10:32601543-32601565 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1066219172 10:33318945-33318967 TGAAGCCAACTGGACTTCCGGGG + Intronic
1066479353 10:35780431-35780453 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1066651810 10:37663339-37663361 GGAAGACAGCAGGACATCCTTGG - Intergenic
1067096840 10:43307198-43307220 TGAAGCCAGCTGGACTTTCTGGG - Intergenic
1067362874 10:45598110-45598132 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1067534173 10:47095773-47095795 TGAGGCCAGCTGCACTTCCTTGG + Intergenic
1067539324 10:47140305-47140327 TGAGGCCAGCTGGACTTCCTGGG - Intergenic
1067559433 10:47294630-47294652 TGAGGCCAGCTGGACTTCCTGGG - Intergenic
1067726508 10:48774908-48774930 GGAATGCAGCTCCACTTCCTTGG - Intronic
1067854656 10:49781819-49781841 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1068142493 10:53025859-53025881 AGGTGCCAGCTGGGCTTCCTGGG - Intergenic
1068143175 10:53030632-53030654 AGGGGCCAGCTGGGCTTCCTGGG - Intergenic
1068267542 10:54672553-54672575 AGAAGTCACCTGGAGTTCCCTGG - Intronic
1068368503 10:56083664-56083686 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1068404581 10:56573313-56573335 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1068456502 10:57261388-57261410 TGAAGCCCACTGGACTTCCTGGG + Intergenic
1068480496 10:57583761-57583783 TGAAGCCAGCTGGACCCCCTGGG + Intergenic
1068484887 10:57645108-57645130 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1068499940 10:57832372-57832394 TGAAGCCAGCTGGACTTCCTAGG + Intergenic
1068501239 10:57841568-57841590 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1068754352 10:60634389-60634411 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1069152735 10:64985338-64985360 TGAAGCCTGCTGGACTTCCTGGG - Intergenic
1069358426 10:67614280-67614302 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1069967833 10:72136184-72136206 TTAAGCCAGCTGGACTTCCTGGG + Intronic
1070073156 10:73109192-73109214 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1070123945 10:73605166-73605188 TGAAGCCAGCTGGACCTCCTGGG - Intronic
1070638589 10:78149108-78149130 TGATGACAGCTGGACTTCCCTGG + Intergenic
1070648710 10:78219583-78219605 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1070660248 10:78300562-78300584 TGAGGCCAGCTGGACTTCCTGGG - Intergenic
1070677751 10:78424058-78424080 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1070687863 10:78502983-78503005 AGAAGGCAGCTGAACGTACCAGG - Intergenic
1071037859 10:81268804-81268826 TAAAGTCAGCTGGACTTCCTAGG + Intergenic
1071054220 10:81490531-81490553 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1071061765 10:81578404-81578426 TAAAGCCAGCTGGACTTCCTGGG + Intergenic
1071156418 10:82694312-82694334 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1071307484 10:84311938-84311960 GGAAGCCAGCTGGACGTCCTGGG - Intergenic
1071527752 10:86367690-86367712 AGGAGACAGCTGAGCTTCCTGGG + Intergenic
1071547370 10:86538727-86538749 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1073527164 10:104194830-104194852 GGCAAGCTGCTGGACTTCCTTGG - Intronic
1074265229 10:111895204-111895226 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1074420843 10:113307768-113307790 AGGTGGCAGTTGGAATTCCTTGG - Intergenic
1074681922 10:115915819-115915841 TGAAGTCAGCTGGCTTTCCTAGG + Intronic
1075146930 10:119890308-119890330 TGAAGCCAGCTAGACTTCCTGGG + Intronic
1075254078 10:120910476-120910498 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1075705802 10:124499691-124499713 AGGAGGCAGCAGGACAGCCTGGG - Intronic
1076067398 10:127459692-127459714 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1076079231 10:127563727-127563749 AGAAGACAGCTGGTGTTCCGCGG + Intergenic
1076514416 10:131035781-131035803 AGAAGGCAGCTCCAATTCTTAGG + Intergenic
1076896541 10:133315860-133315882 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1076897657 10:133321414-133321436 TGAAGCCAGCTGCACTTCCTGGG - Intronic
1078159633 11:8829514-8829536 AGAAGGAAGATGGACTCCTTGGG - Intronic
1078497344 11:11831719-11831741 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1079382318 11:19948917-19948939 AGAAGGCAGCTGGCCTCCCGGGG + Exonic
1079469823 11:20767597-20767619 TGAAGCCAGCTAGACTTCCTGGG - Intronic
1079746027 11:24131440-24131462 TGAAGACAGCTGGACTTCCTGGG + Intergenic
1079913342 11:26338186-26338208 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1080331957 11:31149251-31149273 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1080820410 11:35800601-35800623 TGAAGCCAGCTGGACCTCCTGGG - Intronic
1080865202 11:36188190-36188212 TGAAGGCACCTGGACTTCCCAGG - Intronic
1081121381 11:39270894-39270916 TGAAGCCAGCTGGACTTGCTGGG + Intergenic
1081145635 11:39560221-39560243 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1081146438 11:39566213-39566235 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1081181443 11:39990254-39990276 AGGTGCCAGCTGGGCTTCCTGGG + Intergenic
1081286304 11:41274492-41274514 TGAAGCCAGCTGGACTTCCTCGG + Intronic
1082011612 11:47453433-47453455 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1083125787 11:60564427-60564449 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1083198741 11:61106543-61106565 GGAAGGGACCTGGCCTTCCTGGG + Intronic
1083315639 11:61813473-61813495 TGAAGCCAGATGGACTTCCTGGG + Intronic
1083637622 11:64129003-64129025 AGCCGGGAGCAGGACTTCCTGGG - Intronic
1084437128 11:69149729-69149751 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1084552937 11:69859316-69859338 TGAGGCCAGCTGGACTTTCTGGG + Intergenic
1084564304 11:69920619-69920641 AGAAAGGACCTGGACCTCCTGGG - Intergenic
1084801351 11:71546322-71546344 TGAGGCCAGCTGGACTTCTTGGG - Intronic
1084801479 11:71547139-71547161 TCAGGGCAGCTGTACTTCCTAGG - Intronic
1086112647 11:83216830-83216852 AGGGGCCAGCTGGGCTTCCTGGG - Intronic
1086169840 11:83823604-83823626 TGAAGGCAGTTGGAAATCCTAGG - Intronic
1086443446 11:86850426-86850448 AGGTGCCAGCTGGGCTTCCTGGG + Intronic
1086844526 11:91731658-91731680 AGGTGCCAGCTGGGCTTCCTGGG - Intergenic
1087349287 11:97011009-97011031 TGAAACCGGCTGGACTTCCTGGG + Intergenic
1087458648 11:98419968-98419990 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1087459346 11:98425109-98425131 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1087679283 11:101201132-101201154 AGAAAGGAGCTGGAGTTCCCAGG + Intergenic
1087874712 11:103342107-103342129 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1087965662 11:104410918-104410940 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1088683487 11:112265378-112265400 AGAAAGCAGTTGGCCTTCCAAGG + Intronic
1089358151 11:117869296-117869318 GGAAGGCAGCTGGACAGTCTAGG + Intronic
1089837433 11:121383470-121383492 AGAAAGCAGCTGCTCTTCCTTGG + Intergenic
1090513119 11:127396538-127396560 TGAAGTCAGCTGGACTGCCTGGG + Intergenic
1091026026 11:132141991-132142013 AGAAGGGAGCTGGAGTTGCAGGG + Intronic
1091127032 11:133109636-133109658 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1091256186 11:134188040-134188062 TGAAGCCAGTTGGACTTCCTGGG + Intronic
1091585595 12:1814511-1814533 TGAAGCCAGCTGGACTTCTTGGG - Intronic
1091703548 12:2679328-2679350 AGAAGGCAGCCCGCCTTCCCAGG + Intronic
1091933586 12:4416958-4416980 TGAAGCCAGCTGGGCTTCCTGGG - Intergenic
1092334900 12:7623448-7623470 TGAAACCAGCTGGACATCCTGGG + Intergenic
1092646554 12:10580489-10580511 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1092690014 12:11098166-11098188 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1092714358 12:11373205-11373227 TGATGCCAGGTGGACTTCCTGGG - Intronic
1093213291 12:16332992-16333014 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1093491300 12:19707737-19707759 AGAAGCCAGCTGGACTTCCTGGG - Intronic
1093517749 12:20010439-20010461 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1093862746 12:24187303-24187325 AGAAAGCAGCAGGACTTCAGTGG - Intergenic
1093967415 12:25341844-25341866 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1094254954 12:28412888-28412910 TGAGGCCAGCTGGACTTCCTGGG - Intronic
1094319380 12:29169136-29169158 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1094320379 12:29175900-29175922 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1094597967 12:31882713-31882735 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1094732888 12:33199092-33199114 TGAAGCCATCTGGACTTCCTGGG + Intergenic
1094776125 12:33730072-33730094 TGAAGCCATCTGGACTTCCTGGG - Intergenic
1095597252 12:43972864-43972886 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1095604745 12:44053162-44053184 AGATGCGAGCTGGACATCCTAGG + Intronic
1096711941 12:53464144-53464166 AGCAGGAACCTGGAGTTCCTGGG - Intronic
1097414276 12:59295363-59295385 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1098231832 12:68378976-68378998 AGAAGACAACTGGTTTTCCTTGG - Intergenic
1098790266 12:74814162-74814184 TGAAGCCAGATGGACTTCCTGGG + Intergenic
1099375923 12:81896403-81896425 TAAAGCCAGCTGGACTCCCTGGG + Intergenic
1099720421 12:86355313-86355335 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1099797860 12:87421524-87421546 TGAAGCCAGCTGAACTTCCTGGG - Intergenic
1100050506 12:90443764-90443786 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1100051111 12:90448493-90448515 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1100209436 12:92386720-92386742 TGAGACCAGCTGGACTTCCTGGG + Intergenic
1100210496 12:92393758-92393780 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
1100528785 12:95445459-95445481 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1100529274 12:95449146-95449168 TGAGGCCAGCTGGACTTCCTGGG - Intergenic
1100530643 12:95458298-95458320 TGAGGCCAGCTGGACTTCCTGGG - Intergenic
1100610005 12:96184022-96184044 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1100984189 12:100189255-100189277 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1101539131 12:105648756-105648778 ACAAGGCAGATGGAATTCTTGGG + Intergenic
1101704527 12:107209710-107209732 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1101705549 12:107217294-107217316 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1103733248 12:123042506-123042528 AGAATGCAGCTGAACTGCGTTGG - Intronic
1103881176 12:124167032-124167054 AGAAGGAAGCTGGGGTTCTTGGG + Intronic
1104230988 12:126883853-126883875 GGAAGCCAGCTGGAATTGCTGGG + Intergenic
1104305832 12:127610374-127610396 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1104306902 12:127617705-127617727 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1104766749 12:131334878-131334900 TGAAGACATCTGCACTTCCTGGG + Intergenic
1105431808 13:20343725-20343747 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1105437205 13:20389514-20389536 CGAAGCCAGCTGGACTTCCTGGG - Intergenic
1105443500 13:20434211-20434233 TGAGGCCAGCTGGACTCCCTGGG + Intronic
1105476306 13:20730623-20730645 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1105489815 13:20877117-20877139 GGAAGCCAGCTGGACTTCCTGGG - Intronic
1105520953 13:21130465-21130487 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1105676867 13:22681038-22681060 TGAAGCCAGCCGGACTTCCTGGG + Intergenic
1105720356 13:23107666-23107688 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
1105725400 13:23158771-23158793 TGAGCCCAGCTGGACTTCCTGGG + Intergenic
1105833200 13:24184028-24184050 TGAAGGCAGCTGGCTTTTCTGGG - Intronic
1106034572 13:26032088-26032110 TGGAGCCAGCTGGACTTCCTGGG - Intergenic
1106062873 13:26312025-26312047 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1106178468 13:27351213-27351235 TGAAGCCACCTGGACTTCCTGGG - Intergenic
1106184857 13:27400383-27400405 TGAAGATAGCTGGACTTCCTGGG + Intergenic
1106201731 13:27543654-27543676 AGAAGGCAGGTAGAAATCCTTGG - Intergenic
1106326705 13:28698260-28698282 TGAAGCCAGCTGGACTTTCTGGG + Intergenic
1106351721 13:28937111-28937133 TGAAGCCAACTGGACTTCCTGGG + Intronic
1106356728 13:28990363-28990385 TGAAGCCAGCTGGACTTACTGGG + Intronic
1106471050 13:30054506-30054528 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1106845802 13:33736630-33736652 TGACGCCAGCTGGACTTCCTGGG + Intergenic
1107069095 13:36250604-36250626 AAAAGGCAGCTGAAATACCTGGG + Intronic
1107170192 13:37332212-37332234 TGAAGTCAGCTGGACTTCCTGGG + Intergenic
1107343053 13:39430570-39430592 TGAAGCCAGCTAGACTTCCTGGG + Intronic
1107558858 13:41542834-41542856 TGAAGCCAGCTGGACTTCTTGGG + Intergenic
1107634796 13:42381252-42381274 TGAAGCCAGCAGGACTTCCTGGG + Intergenic
1107790911 13:44001412-44001434 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1108118931 13:47161805-47161827 TGAAACCAGCTGGACTTCCTGGG - Intergenic
1108149763 13:47521334-47521356 TGAAGCCAGTTGGACTTCCTGGG - Intergenic
1108182368 13:47853775-47853797 AGAAGTCACCTGTACTTTCTTGG - Intergenic
1108500214 13:51063544-51063566 GGAAGGCAGGTGGCCTGCCTGGG - Intergenic
1108515684 13:51200548-51200570 TGAAGCCAACTGGACTTCCTGGG - Intergenic
1108725397 13:53175280-53175302 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1108735443 13:53278907-53278929 TGAAGCCAGCTGGACTTTCTGGG + Intergenic
1108867219 13:54938278-54938300 TGAAGCCAGCTAGATTTCCTGGG + Intergenic
1108867744 13:54942112-54942134 AGGTGCCAGCTGGGCTTCCTGGG - Intergenic
1109138826 13:58687815-58687837 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1109419785 13:62096369-62096391 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1109423978 13:62148965-62148987 TGAAGCCAACTGGACTTCCTGGG + Intergenic
1109425169 13:62157775-62157797 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1109523704 13:63546104-63546126 AGGTGCCAGCTGGGCTTCCTGGG - Intergenic
1109527276 13:63593138-63593160 TGAAGCCAGCTGTACTTCCTGGG + Intergenic
1109735521 13:66479535-66479557 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1110257324 13:73446028-73446050 TGAGGCCAGCTGGACTTCTTGGG - Intergenic
1110906427 13:80896466-80896488 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1111017165 13:82396712-82396734 AGGTGCCAGCTGGGCTTCCTGGG + Intergenic
1111250493 13:85595053-85595075 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1111337971 13:86846946-86846968 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1111372216 13:87333628-87333650 TGAAGCCAGCTGGACTTGCTGGG + Intergenic
1111532060 13:89550577-89550599 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1111540775 13:89664692-89664714 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1111929457 13:94498692-94498714 TGAAGCCAACTGGACTTCCTGGG + Intergenic
1112286537 13:98109522-98109544 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1112412842 13:99178840-99178862 AGAAAGCAGCTGCATTTGCTGGG - Intergenic
1112530008 13:100191762-100191784 AGCAGCCAGCGTGACTTCCTTGG - Intronic
1112775988 13:102844880-102844902 ACATGTCATCTGGACTTCCTGGG - Exonic
1113204278 13:107897601-107897623 TAAAGCCAGCTGGACTTCCTGGG - Intergenic
1113338479 13:109399597-109399619 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1113479954 13:110613528-110613550 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1114575340 14:23707686-23707708 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1114575622 14:23710321-23710343 TGAAGGAAGCTGGAGTCCCTGGG + Intergenic
1115060716 14:29186547-29186569 TGAAGGGAGCTGGACTTCCTGGG + Intergenic
1115736867 14:36341820-36341842 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1115898465 14:38117926-38117948 AGAATGCAGCTGGAAATCTTTGG + Intergenic
1116142515 14:41016637-41016659 AGGGGCCAGCTGGGCTTCCTGGG - Intergenic
1116156141 14:41208721-41208743 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1116305248 14:43245735-43245757 TGAAGCCAGGTGGACTTCCTGGG + Intergenic
1116329798 14:43581129-43581151 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1116520598 14:45842539-45842561 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
1116583641 14:46674640-46674662 AGATGGGAGCTGTGCTTCCTGGG - Intergenic
1116696170 14:48181228-48181250 TTAAGCCAGCTGGACTTCCTCGG - Intergenic
1116698216 14:48202783-48202805 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1117650532 14:57900210-57900232 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1117727917 14:58692489-58692511 GGAAGACAGCTGGACCTGCTGGG + Intergenic
1118379031 14:65202782-65202804 TGAAGCTAGCTGGACTTCCTGGG + Intergenic
1118532183 14:66718782-66718804 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1118547171 14:66904587-66904609 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1118640185 14:67785124-67785146 AGCAGGCAGATGGACTACTTGGG - Exonic
1119030404 14:71187968-71187990 AGGAGGCAGCCAGACTTCCCCGG + Intergenic
1120103807 14:80472528-80472550 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1120335460 14:83148901-83148923 TGAAGCCCGCTGGACTTCCTGGG - Intergenic
1120352939 14:83386526-83386548 AGGTGCCAGCTGGGCTTCCTGGG - Intergenic
1120364971 14:83556414-83556436 TGAAGCCAGCTGAACGTCCTGGG + Intergenic
1120387621 14:83866058-83866080 TGACGCCAGCTGGACTTCCTGGG + Intergenic
1121072194 14:91034380-91034402 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1121144049 14:91568176-91568198 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1121154301 14:91668183-91668205 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1123144477 14:106115630-106115652 GAAAGACAGCTGGAATTCCTGGG - Intergenic
1123814452 15:23962449-23962471 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1123896145 15:24832380-24832402 TGAGGCCAGCTGGACTTCCTGGG + Intronic
1123905567 15:24917179-24917201 TGAAGCCACCTGGACTTCGTAGG - Intronic
1124049811 15:26186583-26186605 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1124056517 15:26245141-26245163 TGAAGCCAGCTGAACTTCCTGGG - Intergenic
1124211352 15:27767382-27767404 TGAAGCCAGCTGGATTTCTTGGG + Intronic
1124247335 15:28082052-28082074 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1124360270 15:29031859-29031881 TGAAGCCAGCTGAACTTCCTGGG - Intronic
1124385848 15:29207716-29207738 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1124436920 15:29657778-29657800 TGAGGCCAGTTGGACTTCCTGGG - Intergenic
1124441026 15:29686416-29686438 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1124613732 15:31226444-31226466 TGAAGCCAGCGGGACTTCCTGGG - Intergenic
1124655996 15:31507873-31507895 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1124701991 15:31923148-31923170 TGAAGTCAGCTGGACTTCCTGGG + Intergenic
1124920262 15:34019157-34019179 TGAAGCCAGCTGGACTTACTGGG - Intronic
1125109559 15:36015090-36015112 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1125325924 15:38535812-38535834 GCAAGACAGCTGGCCTTCCTTGG + Intronic
1125345651 15:38716072-38716094 TAAAGCCAGCTGGATTTCCTGGG + Intergenic
1125555584 15:40582143-40582165 TGAAGTCAGCAGGACTTCCTGGG - Intergenic
1126070598 15:44862042-44862064 TGAAGCCAGCTGAACTTCCTGGG - Intergenic
1126072391 15:44876361-44876383 TGGAGCCAGCTGGACTTCCTGGG - Intergenic
1126085799 15:45010292-45010314 TGGAGCCAGCTGGACTTCCTGGG + Intergenic
1126143236 15:45454565-45454587 AGGAGGCAGCGGGGCTCCCTGGG + Intergenic
1126188196 15:45851220-45851242 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1126280913 15:46948348-46948370 TGAACCCAGCTGGACTTCCTGGG - Intergenic
1126723913 15:51611719-51611741 TGAAGCTAGCTGGACTTCCTGGG + Intronic
1126734838 15:51720632-51720654 TGAAGCCAGCTGGACTTCCTGGG + Exonic
1126895487 15:53252826-53252848 CGAAGGCAGTGGGATTTCCTTGG + Intergenic
1127093228 15:55487099-55487121 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1128376994 15:67083960-67083982 GGAAGTCAACTTGACTTCCTGGG + Intronic
1128397805 15:67246573-67246595 TGAAGCCTGCTAGACTTCCTGGG + Intronic
1128742532 15:70093903-70093925 AGAAGGAAGCTGAAGCTCCTGGG - Intronic
1128785667 15:70395128-70395150 AGAGGGGAGGTGGAATTCCTGGG + Intergenic
1128877435 15:71213962-71213984 TGAAGCCAGGGGGACTTCCTAGG + Intronic
1130028560 15:80291517-80291539 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1130029158 15:80296143-80296165 TGAAGCCAGTTGGACTTCCCAGG - Intergenic
1130045410 15:80440476-80440498 AGAAGGAAGCTGGAGTTAGTGGG + Intronic
1130656718 15:85796403-85796425 TGAAGCCAGCTGGACTTTCTGGG + Intergenic
1130989752 15:88869302-88869324 AGAAGGCAGGTGAAACTCCTGGG + Intronic
1131136169 15:89937706-89937728 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
1131367049 15:91850509-91850531 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1131410841 15:92207161-92207183 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1131411908 15:92214377-92214399 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1131489544 15:92850597-92850619 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1131614903 15:94005936-94005958 TGAAGCCAGCTGGACCTCCTGGG + Intergenic
1131682884 15:94742463-94742485 GGAAGCCAGCTGGACTTCTGGGG - Intergenic
1131719201 15:95148723-95148745 TGAAGCCTGCTGGACTTCCTGGG - Intergenic
1131738326 15:95358744-95358766 TGAGACCAGCTGGACTTCCTGGG + Intergenic
1131782268 15:95872338-95872360 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1131805863 15:96121838-96121860 AGAAAGAGGCTGGACTTGCTTGG + Intergenic
1131949261 15:97663078-97663100 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1132344819 15:101101726-101101748 TGAAGCCAACTGGACTTCCTGGG + Intergenic
1132461901 16:59594-59616 AGAGGGGGTCTGGACTTCCTTGG - Intronic
1135336470 16:21605907-21605929 AGAGGCCAGCTGGAAGTCCTGGG + Intronic
1138168066 16:54821140-54821162 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1138278018 16:55750387-55750409 AGAAGGAAGCTGGCTTTGCTGGG + Intergenic
1138366796 16:56485933-56485955 AGAAGACAAGTGGCCTTCCTTGG + Intronic
1138493906 16:57395437-57395459 TAAAGCCAGCTGGACTTCCTGGG - Intergenic
1138826948 16:60332336-60332358 TGAAGTCAGCTGGATTTCCTGGG + Intergenic
1138953995 16:61949221-61949243 AGAAGGCAGCTGGACTTCCTGGG + Intronic
1139141179 16:64264416-64264438 TGAAGCCAGCTGGACTTCCTAGG - Intergenic
1139527218 16:67524512-67524534 AGAAGGCAGCTGGACAGGCAGGG - Intronic
1139676006 16:68524081-68524103 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1139790406 16:69429536-69429558 CAAAGCCAGCTGGACTTCCTGGG - Intronic
1139965514 16:70742860-70742882 TGAAGGCAGCTGGACTTCCTCGG + Intronic
1140185918 16:72771937-72771959 TGAAGCCAACTGGACTTCCTGGG + Intergenic
1140249088 16:73278918-73278940 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1140631734 16:76861650-76861672 TGAAGCCAGTTGGACTTCCTGGG + Intergenic
1140748308 16:78000308-78000330 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1140953860 16:79844743-79844765 TGAAGGCAGAGGGACTTCCTCGG - Intergenic
1141342238 16:83213751-83213773 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1141473789 16:84258229-84258251 GGAAGCCAGCTGGACTTCCTGGG + Intergenic
1141547451 16:84780602-84780624 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1141969032 16:87467606-87467628 AGATGACAACTTGACTTCCTTGG + Intronic
1142336797 16:89494574-89494596 AGATGGCACCTGGACCACCTTGG - Intronic
1142987056 17:3702056-3702078 TCAAGCCAGCTGGACTTCCTGGG + Intergenic
1143090533 17:4446959-4446981 AAAAGGAAGCTGGACTCACTCGG - Exonic
1143305341 17:5942042-5942064 AGAAAGCTGCTGGACTTCCAGGG - Intronic
1143768310 17:9151749-9151771 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1144017431 17:11209369-11209391 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1145066719 17:19766409-19766431 AGAAGGGAGATGGGCTTCCGGGG + Intergenic
1145803782 17:27711919-27711941 TGAAGCCAACTGGACTTCCTGGG + Intergenic
1145822181 17:27847271-27847293 TGAAGCCAGCTGGGCTTCCTGGG - Intronic
1145883112 17:28365797-28365819 AAGAGCCAGATGGACTTCCTGGG + Intronic
1146295083 17:31643145-31643167 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1146310130 17:31762046-31762068 TGAAGCCAGCTGGATTTCCTAGG + Intergenic
1146311431 17:31771342-31771364 TAAAGCCAGCTGGACTTCCTGGG + Intergenic
1146556517 17:33829489-33829511 AGAAAGCAGTTAGACTCCCTGGG + Intronic
1146591642 17:34132696-34132718 TGAAGCCAGCTGGACTTCGTGGG - Intronic
1147175351 17:38652672-38652694 AGAGGGCAGCTGGAATTCAAGGG + Intergenic
1147253652 17:39168501-39168523 TGAACCTAGCTGGACTTCCTGGG + Intergenic
1147714208 17:42493390-42493412 AGAAGACAGCTGGCCTGCCCTGG + Intronic
1147859783 17:43512090-43512112 AGAAGGCAGATGGACTTGGCCGG + Intronic
1148018346 17:44538225-44538247 TGAAGCTAGCTGGACTTTCTGGG - Intergenic
1148189923 17:45671423-45671445 TGAGGCCAGCTGGACTTCCTGGG - Intergenic
1148221077 17:45862490-45862512 TGAAGCCAGCTGGACTTTCTGGG - Intergenic
1148329426 17:46804695-46804717 TGAGGCCAGCCGGACTTCCTGGG + Intronic
1148502595 17:48103006-48103028 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1149077842 17:52617571-52617593 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
1149097545 17:52861825-52861847 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1149213948 17:54332408-54332430 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1149922785 17:60675048-60675070 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1149964911 17:61152475-61152497 TGAAGCCATCTGGACTTCCTGGG - Intronic
1150135987 17:62695380-62695402 TGAAGCCAGCTGGACTTCCTAGG + Intergenic
1150161179 17:62899408-62899430 TGACGCCAGCTGGACTTCCTGGG - Intergenic
1150178300 17:63086692-63086714 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1150237890 17:63607835-63607857 AGGAAGAAGCTGGACTCCCTGGG + Exonic
1150317211 17:64179087-64179109 TGAGGCCAGCTAGACTTCCTGGG + Intronic
1150646625 17:66982594-66982616 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1151190238 17:72392965-72392987 AGAAGGCATCTGGGATGCCTGGG - Intergenic
1151344996 17:73496051-73496073 AAAAGGAACCTGGACTTCCCGGG + Intronic
1151463095 17:74267027-74267049 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1152355217 17:79803567-79803589 GAGAGGCAGCTGGACCTCCTGGG + Intergenic
1152996013 18:406929-406951 AGTAGGCAGCTTCACTCCCTAGG + Intronic
1153300447 18:3587367-3587389 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1153665617 18:7365480-7365502 TGAAGCCAGCTAGACATCCTGGG - Intergenic
1153668485 18:7387653-7387675 TGAGGCCAGCTGGACTTCTTGGG + Intergenic
1153906706 18:9668181-9668203 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1153967105 18:10191974-10191996 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1154080155 18:11248296-11248318 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1155074436 18:22342308-22342330 AGGAGGCCACTGGCCTTCCTGGG + Intergenic
1155352297 18:24918379-24918401 ACAAGGCAGCTGAACTTCTCTGG + Intergenic
1155475364 18:26232186-26232208 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1155477095 18:26245771-26245793 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1155574001 18:27225358-27225380 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1155602934 18:27569889-27569911 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1155966194 18:32037649-32037671 TGAGGCCAGCTGGACTTCCCGGG + Intronic
1156356738 18:36348707-36348729 AGAAGACAGCAGCACTTGCTGGG - Intronic
1156954349 18:42943416-42943438 TGAAGTCAGCGGGACTTCCTGGG - Intronic
1157045230 18:44094778-44094800 AGGTGTCAGCTGGGCTTCCTGGG + Intergenic
1158208933 18:55024371-55024393 ATAAGGAAGCTGGTCTTCCCAGG - Intergenic
1158422987 18:57312687-57312709 AGAATGCAGCTGGGCCTTCTGGG + Intergenic
1158482265 18:57832267-57832289 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1159158880 18:64618908-64618930 AGAATGCAGCTGGCTTGCCTTGG - Intergenic
1159161590 18:64648775-64648797 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1159163239 18:64671278-64671300 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1159312049 18:66721771-66721793 TGAAGCCAGCTGGATGTCCTGGG - Intergenic
1160712505 19:559014-559036 TGAAGGCAGCTGGCCCTGCTGGG + Intergenic
1160973875 19:1782944-1782966 AGGGGGGAGCTGTACTTCCTGGG + Exonic
1161275719 19:3415685-3415707 AAAAGGCAGCAGGGCTTCCTCGG - Intronic
1161597592 19:5158835-5158857 TGAAGTCAGCTGGACTTCCTGGG - Intronic
1161598561 19:5165755-5165777 TGAGGCCAACTGGACTTCCTGGG - Intronic
1161897327 19:7092322-7092344 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1162289455 19:9768085-9768107 CAAAAGCAGCTGAACTTCCTAGG - Intronic
1162639890 19:11999988-12000010 AGAAGCGAGATGGTCTTCCTGGG - Intergenic
1163632433 19:18424315-18424337 AGAATGGAGCTGGGCATCCTGGG - Intronic
1164029505 19:21389649-21389671 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1164505346 19:28856018-28856040 AGAATGCAGCTGTACTTTCAAGG - Intergenic
1164993339 19:32700493-32700515 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1165884554 19:39068652-39068674 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1165894569 19:39133844-39133866 GGAAGGCGGCCGGTCTTCCTGGG + Intronic
1167760847 19:51447906-51447928 TGAAGCGAGCCGGACTTCCTGGG - Intergenic
1168092401 19:54094900-54094922 TGAAGCCAGCTGGACTTCCTGGG - Exonic
925181376 2:1819118-1819140 AGGAGGCAGGTGGACTCCCTGGG - Intronic
925421847 2:3719014-3719036 TGAAGCCAGCTGGACTTCCTGGG - Intronic
925489134 2:4372625-4372647 AGATGGCAGCTGGCCTACATCGG - Intergenic
926512659 2:13801851-13801873 TGAGGCCAGCTGGACTTCCTGGG - Intergenic
926927780 2:18005116-18005138 AGTAGGAAGCTGGACTTGTTGGG - Intronic
927184370 2:20471726-20471748 AGAAGGAAGCAGGACATCCAAGG + Intergenic
927864440 2:26579671-26579693 AGAAGGTAGCTGGACCTGCCAGG - Intergenic
928106733 2:28475388-28475410 TGAGGCCAGCTGGACTTCCGGGG - Intronic
928595974 2:32859148-32859170 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
928700152 2:33890759-33890781 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
929254223 2:39791950-39791972 TGAGGCCAGCTGGACTTCCTGGG - Intergenic
929330014 2:40672000-40672022 TGTAGCCAGCTGGACTTCCTGGG + Intergenic
929330799 2:40677833-40677855 TGAAGCCAGTTGGACTTCCTGGG + Intergenic
929804401 2:45132143-45132165 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
930445049 2:51459848-51459870 AGAAGGAAGCTGGCATTCATTGG - Intergenic
931583413 2:63801779-63801801 TGAGGCCAGCTGGACTTTCTGGG - Intronic
931768402 2:65477089-65477111 TGAAGCCAGATGGACTTCCTGGG - Intergenic
932085125 2:68750985-68751007 AAATGTCAGCTGGACTTGCTGGG - Intronic
932374274 2:71221761-71221783 TGAGGACAGCTGGATTTCCTGGG + Intronic
932449395 2:71799893-71799915 TGAAGGCAGCTGGTCACCCTTGG - Intergenic
932960805 2:76410099-76410121 TGAAGCTAGCTGGACTTTCTGGG - Intergenic
933183730 2:79255666-79255688 AGAAGGAAGCTGGAATAGCTTGG + Intronic
933537887 2:83599917-83599939 TGAAGCCAGCAGGACTTCCTGGG - Intergenic
933611296 2:84438692-84438714 TGAAGCCAGCTGGACTTCCTGGG + Intronic
933623345 2:84570247-84570269 TGAAGCCAGCTGGACTTCCTGGG + Intronic
933687542 2:85155153-85155175 TGAAGCCAGCTGGACTTCCTTGG + Intronic
933730911 2:85455771-85455793 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
934020568 2:87947377-87947399 AGGGGCCAGCTGGACTTCCTGGG + Intergenic
934060797 2:88291030-88291052 CGAAGCCAGCTGGACTTCTTGGG + Intergenic
934149898 2:89136198-89136220 TGAGGCCAGCTAGACTTCCTGGG + Intergenic
934217397 2:90045833-90045855 TGAGGCCAGCTGGACTTCCTGGG - Intergenic
934866763 2:97821100-97821122 TGAAGTCAGCTGGACTTCCTGGG + Intronic
934867846 2:97829181-97829203 GGAAGCCAGCTGGATTTCCTGGG + Intronic
934945182 2:98536039-98536061 AGCAGTCAGCTGGACTCTCTGGG + Intronic
935026765 2:99284590-99284612 AGGAGGCAGCTGGAGTTTCGGGG + Intronic
935482981 2:103616515-103616537 TGAAGCCAGCTGGACTTCCTTGG + Intergenic
935761025 2:106320834-106320856 TGAAGCCAGCTGGACTTCTTGGG - Intergenic
935789446 2:106577560-106577582 TGAGGCCAGCTGGACTTCCTGGG - Intergenic
936090136 2:109496449-109496471 TGAAGCCAGCTGGACTTCCTGGG - Intronic
936249423 2:110856223-110856245 TGAAGCCAGCTGGATTTCCTGGG - Intronic
936384561 2:112017390-112017412 TGAAGCCAGCTGGACTTTCTGGG - Intronic
936483769 2:112908893-112908915 TGAGGCCAGGTGGACTTCCTGGG - Intergenic
936802071 2:116282422-116282444 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
936803008 2:116289146-116289168 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
936922671 2:117705235-117705257 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
937050462 2:118884144-118884166 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
937210899 2:120269691-120269713 TGAAGCCAGCTGGACTTCCTGGG - Intronic
937454827 2:122032176-122032198 AGAATGAAGATGAACTTCCTCGG + Intergenic
937622222 2:124001922-124001944 ACAAGGCAGCTTGCTTTCCTGGG + Intergenic
937668371 2:124512997-124513019 ACAAGGCACCTGGCCTGCCTTGG - Intronic
937706587 2:124927754-124927776 TGAAGCCAGCTGGACTTCGTGGG + Intergenic
938056113 2:128215930-128215952 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
938129348 2:128697916-128697938 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
938163361 2:129005944-129005966 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
938196046 2:129329370-129329392 TGAAGCCAGTTGGACTTCCTGGG + Intergenic
938400590 2:130987681-130987703 TGATGCCAGCTGGACTTCCTGGG - Intronic
938911394 2:135888683-135888705 TGAAGCCAGTGGGACTTCCTGGG + Intergenic
939015422 2:136898127-136898149 TGAAGCCAGCTAGATTTCCTGGG - Intronic
939085306 2:137711135-137711157 AGGGGCCAGCTGGGCTTCCTGGG - Intergenic
939551977 2:143626816-143626838 TGAAGCCAGCTGGAATTCCTGGG - Intronic
939814882 2:146881691-146881713 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
939851487 2:147311316-147311338 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
939852571 2:147318717-147318739 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
939912047 2:147994927-147994949 TGAAGCCAGCTGGACTTCCTGGG + Intronic
939956348 2:148530607-148530629 TGAAGGTAGCTGAGCTTCCTGGG + Intergenic
941905414 2:170714023-170714045 AGGAGGCAGGTGGCCCTCCTCGG + Exonic
942104877 2:172624166-172624188 AAAAGGATTCTGGACTTCCTTGG - Intergenic
942111407 2:172686257-172686279 TGAAGCCAGCTGGATTTCCTGGG + Intergenic
942111923 2:172691038-172691060 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
942172510 2:173301855-173301877 TGAAGCCAGCTGGACTTTCTGGG - Intergenic
942304611 2:174593924-174593946 AAAAGGCAGCTGGACTCCAGAGG + Intronic
942425597 2:175857360-175857382 TGAAGCCAGCTGGACTTCCTAGG + Intergenic
943179223 2:184522266-184522288 AAAAGTCAGATAGACTTCCTTGG + Intergenic
943294281 2:186117143-186117165 TGAAGCCAGCTGGACTTCTGAGG - Intergenic
943313764 2:186359764-186359786 AGAAGGCAGGTGGAGTTTCCAGG - Intergenic
943577694 2:189650683-189650705 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
943608576 2:190005471-190005493 TGAAGCCAGCTGGACTTCCTGGG - Intronic
943897461 2:193383460-193383482 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
944053074 2:195493433-195493455 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
944799585 2:203226599-203226621 ATCACACAGCTGGACTTCCTAGG - Intergenic
944846493 2:203673545-203673567 TGAAGCCAGCAGGACTTCCTTGG - Intergenic
944857273 2:203780020-203780042 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
945600809 2:211862820-211862842 TGAAGCCAGTTGGACTTCCTGGG + Intronic
945825773 2:214718168-214718190 TGAAGCTAGCTGGACTTCCTGGG - Intergenic
946939241 2:224753892-224753914 TGAAGCCAGATGGACTTCCTGGG - Intergenic
948662461 2:239515720-239515742 AGGAGGCAGGTGCACTTCCTGGG - Intergenic
949038946 2:241836305-241836327 CAAAGCCAGCTGGACTTCCTGGG - Intergenic
1168969403 20:1920500-1920522 AGCAGGCAGAAGCACTTCCTGGG - Intronic
1169647994 20:7834827-7834849 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1169773607 20:9228328-9228350 AGAAGGCAGGTGATTTTCCTGGG + Intronic
1169853590 20:10079219-10079241 TGAAGCCAGCTGGACTTCCCGGG - Intergenic
1170581194 20:17700824-17700846 GGAAGGCAGCTGTGCCTCCTGGG - Intronic
1171114055 20:22509213-22509235 AGAAGGCAGGTGGACAACATAGG - Intergenic
1171185533 20:23121634-23121656 AGCAAGAAGCTGCACTTCCTCGG + Intergenic
1172310704 20:33916071-33916093 AGAAGGCAGCTGAACGGACTGGG - Intergenic
1172340261 20:34152067-34152089 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1172479100 20:35260550-35260572 GGAAGGCAGCTCTGCTTCCTGGG - Intronic
1173079612 20:39853106-39853128 GGAAGGCAGCTGCTCTTCCAAGG - Intergenic
1173242717 20:41312066-41312088 TAAAGCCAGCTGGACTTCCTGGG + Intronic
1173292640 20:41728069-41728091 TCAAGCCAGCTGGACTTCCTGGG - Intergenic
1174181403 20:48677198-48677220 AGAAGGCAGGTGGGGCTCCTTGG - Intronic
1174849034 20:53973864-53973886 TGAAGCCAGCTGGATGTCCTGGG + Intronic
1175658243 20:60790591-60790613 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1175999194 20:62824547-62824569 AGGAGGCAGCTGGGCTCCCATGG + Intronic
1176250979 20:64119791-64119813 CGAAGGCACGTGGAGTTCCTGGG + Intergenic
1176701548 21:10057573-10057595 TGAAGCCCGCTGGACTTCCTAGG - Intergenic
1177134732 21:17296939-17296961 TGAGGCCGGCTGGACTTCCTGGG + Intergenic
1177136075 21:17306477-17306499 TGAGGCCAGCTGAACTTCCTGGG + Intergenic
1177140677 21:17354364-17354386 TGAAGCCAGCTGAACTTCCTGGG + Intergenic
1177642087 21:23856838-23856860 TGAAGGCAGCTGGACTTCCTGGG + Intergenic
1177851639 21:26355759-26355781 GGAAGCCAACTGAACTTCCTGGG + Intergenic
1177967953 21:27751827-27751849 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1178517150 21:33257711-33257733 TGAGGCCAGCTGGACTTCCTGGG - Intronic
1178602276 21:34004964-34004986 AGAAGGCATCTGTATTTTCTGGG + Intergenic
1178689359 21:34738495-34738517 AGAAGGCGGCTGGCCTTCTGAGG - Intergenic
1179415896 21:41198507-41198529 AGAAGGCAGCTGGAAAGCCCTGG - Intronic
1179472753 21:41622424-41622446 TGATGGCAGCTGGCGTTCCTCGG + Intergenic
1179837705 21:44048239-44048261 TCAAGACAGCTAGACTTCCTAGG - Intronic
1181894487 22:26094911-26094933 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1182553192 22:31112943-31112965 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1182592645 22:31393876-31393898 TGAAGCCAGCTGGACTTCCTTGG + Intergenic
1182642945 22:31783004-31783026 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1182792818 22:32967182-32967204 AGATGGCAGCTGTACAGCCTGGG - Intronic
1182861817 22:33566904-33566926 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1183585199 22:38749381-38749403 AGAAGGAAGATGGACTTTCTGGG + Intronic
949228214 3:1719224-1719246 TGAAGCCAGCTGAACTTCCTGGG - Intergenic
949449347 3:4167657-4167679 AAGAGCCAGCCGGACTTCCTGGG - Intronic
949643489 3:6066747-6066769 AGGTGCCAGCTGGGCTTCCTGGG + Intergenic
949671875 3:6406968-6406990 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
950163833 3:10779201-10779223 AGAAGGTGGCTGCAGTTCCTGGG - Intergenic
950204030 3:11064234-11064256 TGAAGCCAGCTGGACTTGCTGGG - Intergenic
950226681 3:11241391-11241413 TGAAGCCAGCTGGACTCCCTGGG + Intronic
950238827 3:11349257-11349279 TGAAACCAGCTGGACTTCCTGGG - Intronic
950286961 3:11752580-11752602 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
950306438 3:11918173-11918195 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
950581562 3:13865722-13865744 AGAAAGGAGCTGGCCTGCCTGGG + Intronic
950852611 3:16077147-16077169 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
951020122 3:17774269-17774291 TGAAGCCAGCTGGACTTCCTGGG + Intronic
951021119 3:17781659-17781681 TGAAGCCAGCTGGACTTCCTGGG + Intronic
951907222 3:27717358-27717380 AGATGGCAGCTGGACTACCATGG - Exonic
952302447 3:32115425-32115447 TGAAGCCAGCTGGACTTCTTGGG - Intronic
952554717 3:34519391-34519413 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
952555417 3:34524572-34524594 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
952631183 3:35469325-35469347 TGAAGCCAGCTGGACTTGCTGGG - Intergenic
953024959 3:39139401-39139423 AGAAGCCAGCTGGACTTGGCGGG - Intergenic
953361136 3:42297794-42297816 ACAAGGCAGCTGGATGTCCTGGG + Intergenic
953622351 3:44544024-44544046 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
953623310 3:44550936-44550958 TGAAGCCAGCTGGAATTCCTGGG - Intergenic
953995752 3:47518450-47518472 CCAAGGCAGCTGGAGTTCATAGG - Intergenic
954231507 3:49221481-49221503 TGAATCCAGCTGGACTTCCTGGG - Intronic
954232634 3:49229227-49229249 TGAAGCCAGCTGGACTTCCTGGG - Intronic
955090890 3:55749431-55749453 TGAGGCCAGCTGGACTTCCTGGG + Intronic
955343510 3:58143767-58143789 AGAAATCAGCTGGACCTGCTAGG - Intronic
956311701 3:67888111-67888133 TGAAGCCAGCCTGACTTCCTGGG + Intergenic
956846577 3:73189120-73189142 AGAAGACAGATGGACTGCATAGG - Intergenic
959285322 3:104400914-104400936 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
959306839 3:104678044-104678066 TGAAGCCAGCTGGACTTACTGGG + Intergenic
959334383 3:105045788-105045810 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
959414855 3:106071863-106071885 TGAAGCCAGTTGGACTTCCTGGG + Intergenic
959564270 3:107818401-107818423 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
959651804 3:108757605-108757627 AAAAGGCAGGAGGACTCCCTTGG - Intergenic
960063288 3:113346027-113346049 TGAACCCAGCTGGACTTCCTGGG + Intronic
960064093 3:113352077-113352099 TGAAGCCAGCTGGACTTCCTGGG + Intronic
960246249 3:115403528-115403550 AGAAGGCAACATGTCTTCCTGGG - Intergenic
960352080 3:116606284-116606306 TGAAGCCAGCTGGACTCTCTGGG + Intronic
960445457 3:117743508-117743530 TGAAGCCAGCTGGACCTCCTGGG - Intergenic
960865801 3:122199177-122199199 TGCAGGCAGCTGCAGTTCCTTGG - Intronic
961055270 3:123782515-123782537 AGAAGGAATCTGAACATCCTGGG + Intronic
961233599 3:125343342-125343364 TGAAGCCAGCTGGACTTCCTGGG + Intronic
961261301 3:125604332-125604354 TGAAGCCAGCTGGGCTTCCTGGG + Intergenic
961529785 3:127533455-127533477 AGGAGGCAGCTTGGCTGCCTTGG + Intergenic
961746855 3:129069299-129069321 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
963103796 3:141628335-141628357 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
963403107 3:144826615-144826637 TGAAGCCGGCTGAACTTCCTGGG - Intergenic
963409578 3:144910044-144910066 TGAACCCAGCTGGACTTCCTGGG - Intergenic
963431158 3:145205442-145205464 TGAAGCCAGCTGGATTTCCTGGG - Intergenic
963696352 3:148570616-148570638 TGAAGCCAGTTGGACTTCCAGGG + Intergenic
963697336 3:148577601-148577623 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
964083731 3:152790613-152790635 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
964604924 3:158550272-158550294 TGAAGCCAGCTGGACTTCTTGGG - Intergenic
964866202 3:161264601-161264623 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
964967709 3:162518274-162518296 AGAAGGAAGCTGGAGTTCCCTGG - Intergenic
965249106 3:166319066-166319088 TGAAGCCAGCTGGACTTCTTGGG - Intergenic
966039282 3:175461440-175461462 TGAAGCCAGCTGGAATTCCTGGG - Intronic
967576940 3:191105460-191105482 AGGAGCCAGCTGGGCTTCCTGGG - Intergenic
967734608 3:192939159-192939181 TGCAGCCAGCTGGACTTCCTGGG - Intergenic
968212838 3:196863418-196863440 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
968384404 4:123568-123590 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
968916839 4:3500346-3500368 AGAAAGCAGCTGCACTACATGGG + Intronic
970402725 4:15733538-15733560 TGAAGCCAGCTGGACTTCCTAGG - Intronic
970657382 4:18246420-18246442 TGAGGCCAGCTAGACTTCCTGGG - Intergenic
970699985 4:18724917-18724939 TGAAGCCAGCTGGATTTCCTGGG + Intergenic
971533738 4:27721790-27721812 TGAAGCTAGCTGGACTTCCTGGG - Intergenic
971578127 4:28302964-28302986 TGAAGCCAGCTGAACTTCCTGGG + Intergenic
971579035 4:28309850-28309872 TGAAGTCAGCTGGACTTCCTGGG + Intergenic
971630610 4:28988303-28988325 TGAAGCCGGCTGGACTTCCTGGG - Intergenic
972035409 4:34513685-34513707 TGAAGTGAGCTGGACTTCCTGGG + Intergenic
972132820 4:35859430-35859452 CGAAGCCAGCTGGACTTCCTGGG - Intergenic
972133649 4:35864980-35865002 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
972361055 4:38325719-38325741 TGAAGCCAGCTGGACTTTCTGGG - Intergenic
972651450 4:41021356-41021378 TGAAGTCAGCTGGACTTCCTGGG + Intronic
972880760 4:43418910-43418932 AGGGGCCAGCTGGGCTTCCTGGG - Intergenic
972889298 4:43536545-43536567 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
973889276 4:55353179-55353201 TGAAGCCAGCTGGACTTCCTGGG + Intronic
974127927 4:57718348-57718370 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
974188418 4:58470272-58470294 AGAAAGCAGCTGGACTACATTGG + Intergenic
974395615 4:61330914-61330936 TGAAGCCAGCTGGACTTCCTGGG - Intronic
974509788 4:62823685-62823707 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
974520277 4:62973711-62973733 AGGTGCCAGCTGGGCTTCCTGGG + Intergenic
974534182 4:63153491-63153513 TGAAGCCAGCTAGACTTCCTGGG - Intergenic
974735211 4:65921531-65921553 TGAAGCCAGGTGGACCTCCTGGG - Intergenic
974992998 4:69116526-69116548 AGGTGCCAGCTGGGCTTCCTGGG + Intronic
974994676 4:69140103-69140125 AGAGGCCAGCTGGGCTTCCTTGG + Intronic
975019262 4:69467160-69467182 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
975307131 4:72863114-72863136 AGCAGGCAGCAGAGCTTCCTTGG + Intergenic
975693633 4:76990371-76990393 TGAAGCCAGCTGGCCTTCCTGGG - Intronic
976174005 4:82334296-82334318 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
976174719 4:82339273-82339295 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
976631938 4:87247703-87247725 TGAAGCCAGCTGGACCTCCTGGG + Intergenic
976727469 4:88228648-88228670 TGAAGCCAGCTGGACTTCCTGGG + Intronic
977024452 4:91798513-91798535 TGAAGCCAGCTGGACTTCCCGGG + Intergenic
977408549 4:96632211-96632233 TTAAGCCAGCTGGACTTCCTGGG + Intergenic
977449887 4:97181958-97181980 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
977479108 4:97551237-97551259 TGAAGCCAGCTGGGCTTCCTGGG - Intronic
978231848 4:106409402-106409424 AGGGGCCAGCTGAACTTCCTGGG + Intergenic
978319496 4:107478467-107478489 AGCATGCAGCTGCACTGCCTTGG - Intergenic
979235239 4:118392583-118392605 TGAAGCCAGCTGGACTGCCTGGG + Intergenic
979420085 4:120493590-120493612 TTAAGCCAGCTGGACTTCCTGGG + Intergenic
980001734 4:127497501-127497523 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
980186031 4:129462368-129462390 AGGGGCCAGCTGGGCTTCCTGGG - Intergenic
980291263 4:130849322-130849344 TGAAGTCAGCTGGACTTCCTGGG - Intergenic
980373712 4:131913820-131913842 TGAAGCCAGCTGGACTTCCTAGG - Intergenic
980571286 4:134623337-134623359 AGGTGCCAGCTGGGCTTCCTGGG - Intergenic
980760200 4:137222836-137222858 TGAAGCCAGCTGGCCTTCCGGGG + Intergenic
980902351 4:138916827-138916849 GAAAGGCTGCTGGACTTCTTAGG - Intergenic
981159729 4:141483667-141483689 TGAAGCCAGCTGGACTTCTTGGG + Intergenic
981689405 4:147490255-147490277 AGAAGGCAACTGGCATTCATTGG - Intronic
982439677 4:155421294-155421316 AGGTGCCAGCTGGGCTTCCTGGG + Intergenic
982486203 4:155968582-155968604 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
982488771 4:156001936-156001958 CAAAGCCAGCTGGACTTCCCTGG + Intergenic
982637369 4:157913886-157913908 TGAATGCAGGTAGACTTCCTTGG - Intergenic
982773017 4:159415304-159415326 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
982893522 4:160886439-160886461 TGAAGCCAGGTGGACTTCCTGGG - Intergenic
983033743 4:162836599-162836621 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
983033753 4:162836682-162836704 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
983159717 4:164397337-164397359 AGCAGGCAGTTGGCTTTCCTTGG + Intergenic
983207903 4:164930559-164930581 TGAAGCCAACTGAACTTCCTGGG - Intergenic
983473983 4:168192791-168192813 TGAAGCCAGTTGGACTTCCTGGG + Intergenic
984026813 4:174552441-174552463 TGAAGCCAGCTGGACTTCTTGGG - Intergenic
984180489 4:176476854-176476876 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
984228707 4:177066754-177066776 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
984270349 4:177541693-177541715 TGACGCCAACTGGACTTCCTGGG - Intergenic
984290558 4:177788908-177788930 AGGTGCCAGCTGGGCTTCCTGGG + Intronic
984293929 4:177830063-177830085 AGAAGCCAGCTGGACTTCATGGG + Intronic
984340843 4:178454127-178454149 TGAAGCCAGATGGACATCCTGGG - Intergenic
984773990 4:183464536-183464558 TGAAGCGAGCTGGACTTCCTGGG - Intergenic
985178926 4:187235495-187235517 AGGGGGTGGCTGGACTTCCTCGG + Intergenic
985553529 5:544948-544970 CGAAGCCAGCTGGACTTCCTGGG + Intergenic
985559690 5:577647-577669 GAGAAGCAGCTGGACTTCCTGGG - Intergenic
985664173 5:1173375-1173397 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
986285962 5:6359213-6359235 AGAGGGCATCTGGTCTGCCTGGG + Intergenic
986301059 5:6478826-6478848 AGAATGCATCTGCACGTCCTAGG - Intronic
986871133 5:12048169-12048191 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
986929151 5:12796181-12796203 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
987343314 5:16957305-16957327 TGAAGCCAGCTGGACTTCCCGGG + Intergenic
987361627 5:17112346-17112368 TGAAGCCAGCTGGACTTCCTGGG + Intronic
987363877 5:17130987-17131009 TGAAGCCAGTTGGACTTCCTGGG - Intronic
987467162 5:18285690-18285712 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
987673512 5:21045084-21045106 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
987818748 5:22934876-22934898 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
987929526 5:24387050-24387072 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
988039963 5:25876342-25876364 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
988357471 5:30197746-30197768 TGAAGCCAGCTGGACATCCTGGG + Intergenic
988358370 5:30204669-30204691 TGAAGCCAGCCGGACTTCCTGGG + Intergenic
988619170 5:32804943-32804965 TGAAGCCAGCTAGACTTCCTGGG - Intergenic
988931426 5:36039323-36039345 AGCAGCCAGCTGGAGTTCTTGGG - Intronic
989069488 5:37496020-37496042 TGAAGCCAGCTGGACTTTCTGGG + Intronic
989281832 5:39653298-39653320 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
989591025 5:43113131-43113153 TGAAGCTAGCTGGACTTCTTGGG - Intronic
989759801 5:44999957-44999979 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
989761013 5:45016456-45016478 TGAAGCCAGCTGGACTTCCTAGG - Intergenic
989780072 5:45254192-45254214 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
990176321 5:53112345-53112367 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
990216741 5:53541191-53541213 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
990367335 5:55084671-55084693 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
990698210 5:58446425-58446447 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
991107777 5:62862702-62862724 AGAAGGCAGGGGGACCTTCTGGG + Intergenic
991177966 5:63712648-63712670 TGAAGCCACCTGGACTTCCTGGG + Intergenic
991997751 5:72404820-72404842 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
992545390 5:77809933-77809955 TGAAGCCAGCTGGACTTCCTGGG + Intronic
993802348 5:92357993-92358015 TGAAGCCAGTTGGACTTCCTGGG + Intergenic
994489699 5:100425357-100425379 TGAGGCAAGCTGGACTTCCTGGG + Intergenic
994496877 5:100523760-100523782 AGAATGCAGCTGTAAATCCTGGG - Intergenic
994756271 5:103797407-103797429 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
994908594 5:105872481-105872503 AGGTGCCAGCTGGACTTCCTGGG + Intergenic
995353443 5:111209686-111209708 AGAAAGCTGGTGGGCTTCCTTGG - Intergenic
996400259 5:123054627-123054649 ACAAGACACCTGGATTTCCTGGG + Intergenic
996425423 5:123308371-123308393 TGAAGCCAGCTGGACCTCCGGGG + Intergenic
996665764 5:126058452-126058474 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
996709977 5:126534587-126534609 TGAAGCCAGCTGTACTTCCTGGG + Intergenic
997150410 5:131487704-131487726 TGAAGCCAGCTGGACTTCCTGGG - Intronic
997259896 5:132457656-132457678 AGGTGGCAGCTGGGCTTCCCAGG - Intronic
997788469 5:136735495-136735517 AGGTGTCAGCTGGGCTTCCTGGG + Intergenic
997799094 5:136841992-136842014 AGTAGGTTGCTTGACTTCCTTGG - Intergenic
997813742 5:136996598-136996620 TGAAGCCAGCTAGACTTCCTGGG + Intronic
999445469 5:151635265-151635287 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
999605937 5:153315894-153315916 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
999794529 5:154976566-154976588 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1000518354 5:162268771-162268793 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1000535438 5:162472484-162472506 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
1000541613 5:162548404-162548426 TGAAGCCAGCTACACTTCCTGGG + Intergenic
1001445789 5:171781767-171781789 TGAGGCCAGCTGGACTCCCTGGG + Intergenic
1001497277 5:172198129-172198151 TGAAGTCAGCTGGACTTCCTGGG - Intronic
1001697713 5:173684545-173684567 TGAAGCCAGCTAGACTTTCTGGG + Intergenic
1002085493 5:176772554-176772576 TGAAGCCAGCTGGCCTTCCTGGG + Intergenic
1002348237 5:178563025-178563047 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1002447189 5:179296732-179296754 GGCAGGCAGCTGGTCTTCCCAGG - Intronic
1002577458 5:180182796-180182818 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1002615565 5:180453003-180453025 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1002617562 5:180465025-180465047 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1002693776 5:181070556-181070578 AGAAGGCAGCTGCAGCGCCTAGG + Intergenic
1002828005 6:791268-791290 TGAAGCCAACTGGACTTCCTGGG - Intergenic
1002854023 6:1021908-1021930 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1003145315 6:3505376-3505398 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1003243258 6:4362697-4362719 TAAAGGCAACTGGACTTCCTGGG + Intergenic
1003249560 6:4414000-4414022 TGAAGCCAACTGGACTTCCTGGG + Intergenic
1003258564 6:4495342-4495364 AGGAGGCAGGTCTACTTCCTGGG - Intergenic
1003271933 6:4614980-4615002 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1003329842 6:5120894-5120916 CGAAGCCAGCTGGACTTCCTGGG - Intronic
1003715761 6:8644294-8644316 TGAAGCCAGCGGGACTTCCTGGG + Intergenic
1004497934 6:16181966-16181988 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1004508487 6:16265468-16265490 TGAAGCCAGCTTGACTTTCTGGG + Intronic
1004530988 6:16455737-16455759 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1004532243 6:16464113-16464135 TGAGGCCAGCTGGACTTCCTGGG + Intronic
1004545382 6:16593187-16593209 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1004550139 6:16638935-16638957 TGAAGCCAGCTGGACTTCTTGGG + Intronic
1004702169 6:18089557-18089579 TGAAGCCAGCTAGATTTCCTGGG + Intergenic
1005304170 6:24497597-24497619 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1005396024 6:25382838-25382860 TGAAGCCAGCTGAACTTCCTGGG - Intronic
1006759747 6:36449637-36449659 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1006901018 6:37501350-37501372 TAAAGCCAGCTGGACTTCCTGGG - Intergenic
1007029652 6:38616536-38616558 TGAGGCCAGCTGGACTTCCTGGG + Intronic
1008257176 6:49317396-49317418 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1009688017 6:66988300-66988322 TGAAGGCAGCTAGACTTCCTGGG - Intergenic
1009763753 6:68040904-68040926 AGGTGCCAGCTGGACTTCCTGGG - Intergenic
1009846980 6:69146384-69146406 AGAAGGCAGAAGGCCTTCCTGGG + Intronic
1009907655 6:69889439-69889461 TGAAGCCAACTGGACTTCCTGGG + Intronic
1009946593 6:70347755-70347777 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1010045714 6:71440886-71440908 TGAAGCCAGCTGGACTCCCTGGG - Intergenic
1010768941 6:79806582-79806604 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1011225003 6:85095913-85095935 TGAGGCCAGCTGGGCTTCCTGGG + Intergenic
1012041388 6:94208791-94208813 AGTAGGCTGATGCACTTCCTAGG - Intergenic
1012732409 6:102899565-102899587 TGAGGCCAGCTGGACTTCCTAGG + Intergenic
1012738983 6:102989618-102989640 TGAGGCCAGCTGGACTTTCTGGG - Intergenic
1012739754 6:103001157-103001179 AGGTGCCAGCTGGGCTTCCTGGG - Intergenic
1013167422 6:107606498-107606520 AGAAGGGGGCTGAACTTCCTGGG - Intronic
1013790530 6:113831626-113831648 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1013977038 6:116091101-116091123 TGAAGCCAGTTGGACTTCCTGGG + Intergenic
1014201812 6:118617109-118617131 TGATGCCAGCTGGGCTTCCTGGG + Intronic
1014404999 6:121040243-121040265 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1014691061 6:124564117-124564139 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1015032624 6:128613981-128614003 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1015401757 6:132795740-132795762 AGAATCCAGTTGGACTTTCTAGG + Intronic
1015437830 6:133210036-133210058 TGAAGCTAGCTGTACTTCCTGGG - Intergenic
1016248340 6:142014666-142014688 AGGGGCCAGCTGGGCTTCCTGGG + Intergenic
1016677902 6:146793331-146793353 TGAAGCCAGATTGACTTCCTGGG - Intronic
1017353238 6:153469523-153469545 TGAGGCCAGCTGGACTTCCTGGG - Intergenic
1017920443 6:158867988-158868010 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
1018247295 6:161835302-161835324 AGAAGGAAGGGGGGCTTCCTGGG + Intronic
1018414572 6:163590200-163590222 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
1019373681 7:677070-677092 AGAAGGCAGCTGTGATTCCCAGG + Intronic
1019463050 7:1171406-1171428 TGAAGCCACCTGGACTTCCTGGG + Intergenic
1020144425 7:5631883-5631905 ACAAGGCAGCAGGACCTCGTGGG - Intronic
1021135986 7:16965610-16965632 TGAAGCGAGCTGGACTTCCTGGG + Intergenic
1021201517 7:17733081-17733103 TGAAGCCAGCTGGAATTCCTGGG + Intergenic
1021347915 7:19550067-19550089 TGAAGCCAGATGGACTTCCTGGG - Intergenic
1021433659 7:20589560-20589582 TGAAGCCAGCTAGACTTCCTGGG - Intergenic
1021756152 7:23855159-23855181 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1021757109 7:23862155-23862177 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1022457389 7:30570059-30570081 TGAAACCAGCTGGACTTCCTGGG + Intergenic
1023258674 7:38336780-38336802 AGGGGCCAGCTGGGCTTCCTGGG - Intergenic
1024265543 7:47603517-47603539 TGAAGCCAGCTGGATTTCCTGGG + Intergenic
1024285271 7:47751672-47751694 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1024945490 7:54803741-54803763 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
1025105601 7:56169611-56169633 AGAAGTCAGCTGGGCTTACTGGG + Intergenic
1026172760 7:67968799-67968821 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1026379633 7:69786077-69786099 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1026383367 7:69821272-69821294 TGAAGCCAGCTGGACGTCCTGGG + Intronic
1026541528 7:71283798-71283820 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1026549732 7:71357740-71357762 TGAAGCCTGCTGGACTTACTGGG + Intronic
1026865651 7:73822536-73822558 ATCTGGCAGCTGGACTTCTTGGG + Intronic
1027791934 7:82645338-82645360 TGAAGCCAGTTGGACTTCCTGGG + Intergenic
1028012939 7:85672279-85672301 TGAAGCCACCTGGACTTCCTGGG + Intergenic
1028865452 7:95706339-95706361 TGAAGCCAGCTGGACTTCCTTGG + Intergenic
1029290867 7:99501205-99501227 TGAAGCTAGTTGGACTTCCTGGG + Intronic
1029440198 7:100583115-100583137 AGATGGGAGCTGGAGTTCCCAGG + Intronic
1030010844 7:105165385-105165407 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1031350871 7:120729441-120729463 AGAAGGCAGCTGGTGTTCCATGG + Intronic
1031729004 7:125274767-125274789 TGAAGCCAGCTGGACTCCCTGGG + Intergenic
1032016336 7:128382629-128382651 AGAAGGCAGGGGAACTTTCTGGG - Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1032683092 7:134205342-134205364 TGAGGCCAGCTGGACTTCCTGGG - Intronic
1032713953 7:134488088-134488110 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1032722682 7:134563578-134563600 TGAAGCCACCTGGACTTCCTGGG + Intronic
1032722852 7:134564845-134564867 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1032927823 7:136629179-136629201 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1033055740 7:138052144-138052166 TGAAGCCAGCCAGACTTCCTGGG - Intronic
1033604967 7:142920197-142920219 GGAAGGCAGCTTGACTTACATGG - Intronic
1033659940 7:143396277-143396299 AGAAGCCAGCTGGGCTGCCCAGG + Intronic
1033857704 7:145585074-145585096 TGAAGCCAGCTAGACTTCCTGGG + Intergenic
1033979787 7:147149413-147149435 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1034034927 7:147809120-147809142 AGCAGGCAGCTTGCCTTCCTGGG + Intronic
1036099112 8:5757863-5757885 TGAAGCCAGCTGGACTTCCTAGG - Intergenic
1036155013 8:6333381-6333403 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1036200529 8:6767512-6767534 AGAACACAGCTCGACTCCCTAGG + Intergenic
1036920996 8:12855236-12855258 TGAAGCCAGCTGGACATCCTGGG - Intergenic
1037303328 8:17477595-17477617 AGAAGCCAGCTGGACTTCCTGGG + Intergenic
1037373312 8:18203100-18203122 TGGAGCCAGCTGGACATCCTGGG - Intronic
1037980387 8:23249252-23249274 AGACAGCAGCTGGATCTCCTGGG + Exonic
1038012947 8:23489182-23489204 TGAAGCCAGCTGGATTTCCTGGG + Intergenic
1038037215 8:23696623-23696645 GGAAGGCAGATGGACTTCCCAGG + Intergenic
1038430043 8:27492848-27492870 TGAGGCCAGCTGGACTTCCTAGG - Intronic
1038524886 8:28264130-28264152 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
1038674756 8:29613705-29613727 TGAAGCCAGTTGGACTTCCAGGG + Intergenic
1038758088 8:30360542-30360564 AGATGTCAGCTGGACTTGCTAGG - Intergenic
1038911301 8:31967692-31967714 AGAAGGCAGCAGTACTACCAAGG + Intronic
1039129610 8:34248150-34248172 TGAATCCAGCTGGACTTCCTGGG + Intergenic
1039197938 8:35053177-35053199 TGAAACCAGCTGGACTTCCTGGG + Intergenic
1039275625 8:35932073-35932095 TGAAGCCAGCTGGACTTTCTGGG + Intergenic
1039276552 8:35938850-35938872 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1039552008 8:38450284-38450306 TGAGAGCAGCTGGACTTCCCCGG + Intronic
1039842548 8:41304242-41304264 GGAAGGCAGCTCCACTGCCTGGG + Intronic
1040000179 8:42569083-42569105 TGAAGCCAGCTGTACTTCCTGGG + Intergenic
1040526783 8:48232833-48232855 TGAAGCCAGCTGGACTTCCTAGG + Intergenic
1040528135 8:48242206-48242228 TGAAGCCAGCAAGACTTCCTGGG + Intergenic
1040795854 8:51289502-51289524 TGAAGCCAGCTGAACTTCCTGGG - Intergenic
1040797220 8:51299549-51299571 TGAAGCCAGCTGGACTTCCTAGG - Intergenic
1041135186 8:54750504-54750526 AGAAGCCAGCTGGACTTCCTAGG + Intergenic
1041200919 8:55451554-55451576 AGAATGCAGCAGTACTGCCTTGG + Intronic
1041818742 8:62004456-62004478 TGAAGCCAGGTGGACTTCCTGGG - Intergenic
1042771530 8:72387859-72387881 TGAAACCAGCTGGACTTCCTGGG + Intergenic
1042772540 8:72394928-72394950 TGAAGCAAGCTGGACTTCCTGGG + Intergenic
1042919225 8:73906032-73906054 TAAGGCCAGCTGGACTTCCTGGG + Intergenic
1042920347 8:73913595-73913617 TGAGGGCAGCTGGACTTCCTGGG + Intergenic
1043057118 8:75453213-75453235 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1043270669 8:78329562-78329584 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1043703413 8:83319253-83319275 TGAAGCCAGCTAGACTTCCTGGG - Intergenic
1044004621 8:86926181-86926203 TGAGGCCAGCTGGACTTCCTGGG - Intronic
1044068001 8:87722253-87722275 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1044600492 8:93999058-93999080 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1044679128 8:94759422-94759444 TGAAGCCAGCTGAACTTCCTGGG - Intronic
1045198693 8:99956603-99956625 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1045674395 8:104590739-104590761 TGAGGCCAGCTGAACTTCCTGGG - Exonic
1045858182 8:106788716-106788738 TGAAGCCAACTGGACTTCCTGGG + Intergenic
1045858895 8:106793626-106793648 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1045861858 8:106822499-106822521 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1045928480 8:107598071-107598093 AGAGGCTAGCTGGGCTTCCTGGG - Intergenic
1046143084 8:110120647-110120669 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1046522092 8:115338204-115338226 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1048187274 8:132252832-132252854 TGAAGCCAGCTGGTCTTCCTGGG - Intronic
1048210476 8:132450472-132450494 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1048757240 8:137753445-137753467 AGGAGCTAGCTAGACTTCCTTGG - Intergenic
1048931635 8:139319920-139319942 AGTCGGCAGCTGGTATTCCTTGG + Intergenic
1049832686 8:144712497-144712519 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1050872621 9:10592566-10592588 GGAAGCCAGCTGGACTTACTGGG + Intronic
1050923976 9:11240575-11240597 TGAAGCCAGCTGGACTTTCTGGG - Intergenic
1051608531 9:18939682-18939704 AGAAGACACCAGGACTTCCAAGG + Intronic
1051680329 9:19600966-19600988 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1051955455 9:22687614-22687636 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1052318210 9:27138547-27138569 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1052432632 9:28387029-28387051 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1052473494 9:28929466-28929488 AGAAGGCAGCTAGAGTTCTCAGG + Intergenic
1053146055 9:35712865-35712887 AAAAGGCAGCTGGCCATCCAGGG - Exonic
1053532764 9:38898387-38898409 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1053590425 9:39508858-39508880 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1053602538 9:39624943-39624965 TGAGGCCAGTTGGACTTCCTGGG - Intergenic
1053638698 9:40044067-40044089 TGAAGCCAGCTGGACTTCCTAGG - Intergenic
1053767387 9:41421146-41421168 TGAAGCCAGCTGGACTTCCTAGG + Intergenic
1053848281 9:42264247-42264269 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1053860186 9:42378694-42378716 TGAGGTCAGTTGGACTTCCTGGG - Intergenic
1054204990 9:62122816-62122838 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1054251000 9:62717492-62717514 TGAGGCCAGTTGGACTTCCTGGG + Intergenic
1054319492 9:63640630-63640652 TGAAGCCAGCTGGACTTCCTAGG - Intergenic
1054546053 9:66332641-66332663 TGAAGCCAGCTGGACTTCCTAGG + Intergenic
1054565107 9:66752005-66752027 TGAGGCCAGTTGGACTTCCTGGG + Intergenic
1054575878 9:66856431-66856453 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1054633369 9:67465554-67465576 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1055010356 9:71558887-71558909 AGAAGGCAGCTGAGGTTTCTTGG + Intergenic
1055241816 9:74195460-74195482 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1055457844 9:76489713-76489735 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1055458656 9:76495680-76495702 TGAAGCCAGCTGGCCTTCCTGGG - Intronic
1055748288 9:79474924-79474946 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1055951113 9:81730531-81730553 CGAAGCCAGCTGGACTTCCTGGG + Intergenic
1055990278 9:82098640-82098662 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1056608555 9:88108780-88108802 TGAAGGGAGCAGGACTTCCTGGG + Intergenic
1056784688 9:89581984-89582006 CCAAGGCAGCTGGTCTTCCCAGG + Intergenic
1056846444 9:90041732-90041754 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1056884513 9:90428273-90428295 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1057001854 9:91517416-91517438 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1057310438 9:93939638-93939660 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1057341329 9:94204512-94204534 CGAAGCCAGCTGGACTTCCTGGG + Intergenic
1057343472 9:94225347-94225369 TGAACCCAGCTGGACTTCCTGGG + Intergenic
1057395599 9:94677053-94677075 TGAAGCCAGCTGGACTTACTGGG - Intergenic
1057457899 9:95231040-95231062 TGAAGCCAGCTGGACTTCCTAGG - Intronic
1057468006 9:95333181-95333203 TGAAGTCAGCTGGACTTCCTGGG - Intergenic
1057496936 9:95568771-95568793 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
1057509353 9:95664645-95664667 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1057515689 9:95718553-95718575 TGAAGCCAGCTAGACTTCCTGGG - Intergenic
1057516964 9:95729671-95729693 TGAAGCCAGCTGGATTTCCTGGG + Intergenic
1057526173 9:95803919-95803941 TGAAGCCAGCTGGACTTCTTGGG + Intergenic
1057547618 9:96030017-96030039 TGAAGCCAGCTGGACCTCCTGGG + Intergenic
1057551167 9:96051740-96051762 TGAGGCCAGCTGGACTTCCCAGG - Intergenic
1057625668 9:96674140-96674162 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1057843812 9:98506670-98506692 TGAGGGCAGCTGGAGTTCCCTGG + Intronic
1058255721 9:102760198-102760220 TGAAGCCAGCTGGATTTCCTGGG + Intergenic
1058379760 9:104364365-104364387 TGAGGCCAGCTGGACTTCCTGGG - Intergenic
1059848316 9:118306207-118306229 AGAAGGCAGCTGAACTCCATAGG + Intergenic
1060291525 9:122307309-122307331 AGAAGGAAGCTGCACTTTCAAGG - Intronic
1060407577 9:123380491-123380513 GGAAGGCAGCTGGCCTTCCTGGG - Exonic
1061705137 9:132447251-132447273 AGAATGCAGCTGGAAGTGCTGGG + Intronic
1062371663 9:136242408-136242430 AGAAGGCGGCTGGACACTCTAGG + Intronic
1062425448 9:136504063-136504085 AGGAGGCAGGTGGAGGTCCTGGG - Intronic
1062675976 9:137744036-137744058 AGAGGACAGCAGGACTTCCAAGG + Exonic
1062689903 9:137836214-137836236 AAAAGGAAGCTGTACTTCCTTGG - Intronic
1202786567 9_KI270719v1_random:27657-27679 TGAAGCCCGCTGGACTTCCTAGG - Intergenic
1185706437 X:2270736-2270758 TGAAGCCACCTGGACTTCCTGGG + Intronic
1186024033 X:5288887-5288909 TGAAGACAGCTGGACTTCCTGGG - Intergenic
1186401557 X:9265044-9265066 ACACTGCAGCTTGACTTCCTAGG - Intergenic
1186550968 X:10505213-10505235 AGAAGTCAGCAGGACATCATGGG - Intronic
1187010453 X:15273192-15273214 TGAAGCCAGCTGGAATTCCTGGG + Intergenic
1188186959 X:27128117-27128139 AGAAGGCAGATGGTTTTCCCTGG + Intergenic
1188617372 X:32175174-32175196 TGAGGCCAGCTGGACTTTCTGGG + Intronic
1189239846 X:39516658-39516680 ACATGGCAGCTGGGCTGCCTCGG + Intergenic
1189652979 X:43210173-43210195 AGCAGGCATTTGGGCTTCCTTGG + Intergenic
1189810699 X:44778281-44778303 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1189900633 X:45702555-45702577 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1190126188 X:47707738-47707760 AGAAGGCAGCTGGATGTCTAAGG + Intergenic
1190300934 X:49057184-49057206 AGCAGGTAACTGGACCTCCTGGG - Intronic
1190541023 X:51479204-51479226 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1192130094 X:68541688-68541710 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1192482170 X:71495056-71495078 TGAAGCCAGCTGGACTCCCTGGG - Intronic
1192483206 X:71502486-71502508 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1192484550 X:71513771-71513793 TGAAGCCAGCTGGACTTCCTGGG + Intronic
1192486421 X:71530910-71530932 AGAAGCCAGCTGGACTTCCTGGG - Intronic
1193850894 X:86536291-86536313 AGGTGCCAGCTGGGCTTCCTGGG - Intronic
1193870879 X:86796401-86796423 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1193888520 X:87013449-87013471 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1194155616 X:90384232-90384254 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1194156021 X:90389924-90389946 TGAAGCCAGCCGGACTTCCTGGG - Intergenic
1194168579 X:90553773-90553795 TGAAGCCAACTGGAATTCCTGGG - Intergenic
1194250116 X:91563972-91563994 TGAAGCCAGCTGCACTTCCTGGG + Intergenic
1194363926 X:92990222-92990244 TGAGGCCAACTGGACTTCCTGGG - Intergenic
1194794741 X:98197899-98197921 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1195551960 X:106181581-106181603 TGAAGCCAGCTGGACTTCCTAGG - Intronic
1195552777 X:106187031-106187053 TGAAGCCAGCTGGACTTCCTGGG - Intronic
1195579983 X:106490580-106490602 TGAAGCCAGCTGCAGTTCCTGGG - Intergenic
1195621583 X:106961496-106961518 TGAGGCCAGTTGGACTTCCTGGG + Intronic
1196108291 X:111919113-111919135 TGAAGCCAGCTGTACTTCCTGGG + Intronic
1196312874 X:114189008-114189030 TGAGGCCAGCTGGACTTCCTGGG + Intergenic
1196378413 X:115061764-115061786 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1196419803 X:115509823-115509845 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1196419850 X:115510133-115510155 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1196461850 X:115940551-115940573 AAGAGGCTGCTGGACTGCCTTGG + Intergenic
1196681117 X:118470512-118470534 TGAAGCCAGCTGGACTTCCTAGG + Intergenic
1196830133 X:119769287-119769309 TGAAGACAGCAGGACTTCCTGGG + Intergenic
1197398790 X:125962764-125962786 TGAAGCCAGCTGGACGTCCTGGG - Intergenic
1197575614 X:128207646-128207668 AGGTGCCAGCTGGGCTTCCTGGG + Intergenic
1198037565 X:132816802-132816824 AGCTGGCAGCGAGACTTCCTAGG - Intronic
1198416088 X:136421132-136421154 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1198465836 X:136904085-136904107 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1198977328 X:142351440-142351462 TGAAGCTAGCTGGACTTCCTGGG + Intergenic
1199123953 X:144091752-144091774 AGGGGCCAGCTGGACTTCCTGGG - Intergenic
1200139269 X:153890472-153890494 TGAAGCCAGCTAGACTTCCTGGG - Intronic
1200364024 X:155642056-155642078 AGGTGCCAGCTGGGCTTCCTGGG - Intronic
1200392590 X:155958795-155958817 AGGTGCCAGCTGGGCTTCCTGGG - Intergenic
1200502369 Y:3966897-3966919 TGAAGCCAGCCGGACTTCCTGGG - Intergenic
1200514823 Y:4131557-4131579 TGAAGCCAACTGGAATTCCTGGG - Intergenic
1200569079 Y:4805221-4805243 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1200672157 Y:6106459-6106481 TGAGGCCAGCTGGACTTCCTGGG - Intergenic
1200694560 Y:6347490-6347512 TGAAGACAGCTAGACTTCATGGG - Intergenic
1200695314 Y:6353494-6353516 TGAAGCCACCTGGACTTCCTGGG - Intergenic
1200711688 Y:6490359-6490381 TGAAGACAGCTGGACTTCATGGG + Intergenic
1200776885 Y:7177273-7177295 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1200784407 Y:7247165-7247187 TGAAGTGAGCTGGACTTCCTGGG - Intergenic
1200801378 Y:7390122-7390144 TGAAGCCGGCTGGACTTCCTGGG - Intergenic
1200945253 Y:8829319-8829341 TAAAGCCAGCTGGACTTCCTGGG + Intergenic
1200966378 Y:9043001-9043023 TGAAGCCACCTGGACTTCCTGGG + Intergenic
1201022249 Y:9671621-9671643 TGAAGACAGCTGGACTTCATGGG - Intergenic
1201039963 Y:9821216-9821238 TGAAGCCACCTGGACTTCCTGGG + Intergenic
1201040717 Y:9827220-9827242 TGAAGACAGCTAGACTTCATGGG + Intergenic
1201258497 Y:12134216-12134238 TGAAGCCAGCTAGACTTCCTGGG + Intergenic
1201264112 Y:12189386-12189408 TGAAACCAGCTGGACTTCCTGGG + Intergenic
1201271636 Y:12261447-12261469 TGAAGCCAGCTGGACTTTGTGGG - Intergenic
1201272316 Y:12267017-12267039 TGAAGCCAGCTAGACTTCCTGGG - Intergenic
1201311288 Y:12600274-12600296 TGAAGCCAGCTGGACTCCCTGGG - Intergenic
1201312420 Y:12608711-12608733 TAAAGCCAGCTGGACTTCCTAGG - Intergenic
1201321595 Y:12704102-12704124 TGAAGCCGGCTGTACTTCCTGGG - Intronic
1201406738 Y:13657607-13657629 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1201407844 Y:13666209-13666231 TGAAGTCACCTGGACTTCCTGGG - Intergenic
1201454789 Y:14158243-14158265 TGTAGCCAGCTAGACTTCCTCGG + Intergenic
1201456006 Y:14167397-14167419 TGAGGCCACCTGGACTTCCTGGG + Intergenic
1201515333 Y:14814174-14814196 TGAAGCCAGGTGGACTTCCTGGG - Intronic
1201531332 Y:14992182-14992204 TGAGGCCAGCTAGACTTCCTGGG + Intergenic
1201602750 Y:15748860-15748882 AGAGGCCAGCTGGACTTCCTGGG + Intergenic
1201648440 Y:16260963-16260985 TGAAGCCCGCTGGACTTCCTGGG - Intergenic
1201649275 Y:16266979-16267001 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1201653534 Y:16318321-16318343 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1201654370 Y:16324338-16324360 TGAAGCCCGCTGGACTTCCTGGG + Intergenic
1201676814 Y:16595209-16595231 TGAAGCCAGCTGGACTTCCTGGG + Intergenic
1201711049 Y:16992496-16992518 AGAAGCCAGCTGGACTTTCTGGG + Intergenic
1201913270 Y:19155431-19155453 TGAAGCCAGTTGGACTTCCTGGG + Intergenic
1201918916 Y:19213128-19213150 TGAAGCCAGATGGGCTTCCTGGG + Intergenic
1201919828 Y:19222260-19222282 TGAAGCCAGCTGGACTTCTTGGG + Intergenic
1201929110 Y:19321685-19321707 TGAAGCTAGCTGGATTTCCTTGG - Intergenic
1201931228 Y:19351668-19351690 AGAAGCCAGCTGGACTTCCTGGG + Intergenic
1201981444 Y:19914360-19914382 AAGTGCCAGCTGGACTTCCTGGG - Intergenic
1201982152 Y:19919500-19919522 AAGTGCCAGCTGGACTTCCTGGG - Intergenic
1201989235 Y:20006893-20006915 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1201989893 Y:20011778-20011800 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1202021316 Y:20467581-20467603 TGAAGTCAGCTGGACTTCCTGGG + Intergenic
1202082403 Y:21097579-21097601 TGAAGCCAGCTGGACTTCCTGGG - Intergenic
1202089565 Y:21175766-21175788 TGAAGTCAGCTGGACTTCCTGGG - Intergenic
1202147060 Y:21809175-21809197 TGAAGCCACCTGAACTTCCTGGG - Intergenic