ID: 1138959539

View in Genome Browser
Species Human (GRCh38)
Location 16:62012106-62012128
Sequence TCTAGCAAACATTCTTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138959539 Original CRISPR TCTAGCAAACATTCTTAGCC AGG Intronic
902030584 1:13419312-13419334 TCTACTAAAAATACTTAGCCAGG - Intronic
908667786 1:66511202-66511224 TCTAGCAAGCATTCTGAACCAGG + Intergenic
910634511 1:89392349-89392371 TCTGGCAAACATTATCACCCTGG - Intergenic
913365707 1:118036025-118036047 TCTACCAAAAATAATTAGCCAGG + Intronic
918684078 1:187393663-187393685 TCTAGGAAGCATTCTTGGCCTGG + Intergenic
920136662 1:203774907-203774929 TTCAGCAAACATTCTTAGGCTGG - Exonic
921651474 1:217683733-217683755 TTTAGAAAATATTTTTAGCCGGG - Intronic
1065225649 10:23541383-23541405 TTTAGCAAAAATTGTAAGCCGGG - Intergenic
1071662235 10:87516122-87516144 TGTAAAAAACATTCTTGGCCAGG - Intronic
1071792811 10:88973727-88973749 TCTAGCAAACTGTTTTTGCCAGG + Intronic
1072356720 10:94618707-94618729 TCTAGTAGAATTTCTTAGCCTGG - Intergenic
1073200834 10:101733903-101733925 TCTCACAAAAATTATTAGCCAGG - Intergenic
1077098131 11:808537-808559 TCTACCAAAAAATTTTAGCCGGG + Intronic
1078445947 11:11404903-11404925 TCTAGGAAACATGATTGGCCTGG - Intronic
1078905967 11:15688090-15688112 TCTTTCAATCATTCTTAGACAGG + Intergenic
1079747981 11:24156548-24156570 TCTAGCAATGATTCTTAATCAGG + Intergenic
1080422651 11:32125447-32125469 TTTAGCAAACATTCTTAAATAGG + Intergenic
1081707570 11:45193645-45193667 TTTAAAAATCATTCTTAGCCTGG + Intronic
1084078080 11:66797801-66797823 TCTATCAAAATTTCTTGGCCAGG - Intronic
1085680009 11:78564354-78564376 TCTAGTAAAAATAATTAGCCAGG - Intronic
1086047547 11:82550358-82550380 TCAAGCATACCTTCTTTGCCTGG + Intergenic
1086292155 11:85323989-85324011 TCCAGCAAAGATTCTCAGACTGG + Intronic
1087738934 11:101865753-101865775 TCTACTAAAAATACTTAGCCAGG + Intronic
1090122157 11:124041497-124041519 ACTAGCATCCATTCTCAGCCAGG - Intergenic
1091892856 12:4074520-4074542 CCTGGCAAACATCCTTACCCAGG - Intergenic
1093943995 12:25086607-25086629 TCTAGTAGATATTGTTAGCCAGG - Intronic
1098972562 12:76871601-76871623 TCTACTAAAAATACTTAGCCGGG + Intronic
1099307018 12:80970305-80970327 TCCAGCGAACTTTCTTAGACTGG + Intronic
1099331888 12:81299391-81299413 TATAGCAAAGATTATTAGGCAGG + Intronic
1101599774 12:106198974-106198996 GGGAGCAAAGATTCTTAGCCTGG + Intergenic
1104160886 12:126179974-126179996 TCTATCAAACATTTTTGGCAAGG - Intergenic
1107647639 13:42511922-42511944 TTTAAAAAACATTATTAGCCAGG + Intergenic
1110461140 13:75746998-75747020 CCTGGCAAACATACTTAGTCCGG + Intronic
1110508253 13:76315328-76315350 TCTAGAAAACATTTCTGGCCAGG - Intergenic
1112054117 13:95674651-95674673 TCTAGGAAACATTTCTAGGCTGG - Intergenic
1112459504 13:99590731-99590753 TCTAGCAAATAAACTGAGCCAGG + Intergenic
1113167389 13:107457506-107457528 TCTAGTAAATGTTCTAAGCCAGG - Intronic
1116099798 14:40419301-40419323 ACTAGAAAACATTCTAAGCCAGG + Intergenic
1117126395 14:52631494-52631516 TCTTGCAGAGATTCTTAACCTGG - Intronic
1117947587 14:61045580-61045602 TCTAGGAAACATTCTTAACTTGG - Intronic
1118832175 14:69444312-69444334 TCGACCAAAGATTCTTAGCCTGG - Intronic
1121278587 14:92684797-92684819 TCTAGGAAACTTTCTGAGGCTGG + Intronic
1130041169 15:80405990-80406012 TCTAGGAAACATTCTAAGGAGGG + Intronic
1130049903 15:80475257-80475279 TCTAGAAAACATTCTTGGCTGGG + Intronic
1131347526 15:91664567-91664589 TCGTGTAAACATTCCTAGCCTGG - Intergenic
1133630904 16:7620589-7620611 TCTAGCTAACATCTTTAGCCAGG + Intronic
1137507501 16:49067009-49067031 TTTAGCATATTTTCTTAGCCTGG + Intergenic
1137852907 16:51763986-51764008 TCTAGTAAAAATCTTTAGCCAGG + Intergenic
1138019022 16:53460078-53460100 TCTATAAAACATCCTTATCCTGG + Intronic
1138959539 16:62012106-62012128 TCTAGCAAACATTCTTAGCCAGG + Intronic
1138977690 16:62227529-62227551 TCATGCAAACATTGTTAGTCTGG - Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1140223383 16:73059444-73059466 TCTTAAAAAGATTCTTAGCCAGG - Intronic
1141111469 16:81274231-81274253 ACAAGCTAACATTCTTAGCTTGG - Intronic
1141850546 16:86642374-86642396 TATAGCAAACCTTCCTATCCGGG - Intergenic
1142933385 17:3307625-3307647 ACTAGAAAACATTTTGAGCCAGG + Intergenic
1143309457 17:5976491-5976513 TAAAGCAATCATTCTCAGCCTGG + Intronic
1143888729 17:10086155-10086177 TGTAGGAAACATCCTTACCCTGG + Intronic
1146887183 17:36479920-36479942 TATAGCAGTCATTCTCAGCCAGG - Intergenic
1149737706 17:59011937-59011959 TCTAGCAAAAATTCGATGCCTGG + Intronic
1151959507 17:77398268-77398290 TCTAGAAAACCTACTAAGCCAGG - Intronic
1152513653 17:80807887-80807909 TGTAAAAACCATTCTTAGCCTGG + Intronic
1153085362 18:1279334-1279356 CCCAGCAATCATTCTTAACCAGG + Intergenic
1154980143 18:21497084-21497106 TCTAGGAAACATTTTGTGCCAGG - Intronic
1157313830 18:46572297-46572319 TCTAGCAAAACATCCTAGCCTGG + Intronic
1157727679 18:49977521-49977543 TCAAGCACACATTCTGTGCCTGG + Intronic
1158879089 18:61759283-61759305 TCTAGCAAATAGTCAAAGCCAGG + Intergenic
1166285781 19:41827311-41827333 TCTAGTAAACAATCAGAGCCAGG + Intergenic
1168593265 19:57653936-57653958 TCTGGCAAGCATTCTTGGCCTGG + Intergenic
925899989 2:8502442-8502464 ACTTGCAAAGATTCTCAGCCTGG - Intergenic
931108282 2:59081935-59081957 TGAAGTAAACATTCTTAGGCTGG - Intergenic
933290912 2:80437207-80437229 TATAGCAAAATATCTTAGCCTGG - Intronic
935107481 2:100058955-100058977 ATGAGCAAACATTCTTGGCCAGG + Intronic
939021648 2:136964705-136964727 TGTAGCAAACCTGCTTAGCTGGG + Intronic
939053834 2:137338138-137338160 TGCTGCAACCATTCTTAGCCAGG - Intronic
939299327 2:140314659-140314681 TCTACTAATCATTCTGAGCCAGG + Intronic
944471414 2:200056739-200056761 CCCAGCAAGCATTCTTAACCAGG + Intergenic
945441883 2:209889324-209889346 TCTAGAAAACATCCTTAGCCAGG - Intronic
948500602 2:238390522-238390544 GCTATGAAACATTCTTAGCCAGG - Intronic
1170610899 20:17912257-17912279 TCAAAGAAAAATTCTTAGCCAGG + Intergenic
1172977430 20:38917542-38917564 TCTCACAAAGATTCTTACCCAGG - Intronic
1177461745 21:21421438-21421460 TCTAAAACAAATTCTTAGCCTGG - Intronic
1183811417 22:40260975-40260997 TCTTACAAATAATCTTAGCCAGG + Intronic
1183841774 22:40503759-40503781 TCTACTAAAAATACTTAGCCAGG + Intronic
949376791 3:3399918-3399940 CCTAGCAATGATTCTTAACCAGG - Intergenic
949743404 3:7262618-7262640 TTTAGCAAAAATTCTTAACCAGG - Intronic
949803687 3:7931609-7931631 TCAAGCTAACATTCTTAGTGGGG + Intergenic
950612528 3:14135350-14135372 TCTCGCACACACTCTCAGCCAGG + Intronic
950835685 3:15917058-15917080 TCCAGCAAACCTTCCTAGCAAGG - Intergenic
951997407 3:28746716-28746738 TTTATCAAACATTCTAAACCTGG - Intergenic
952158127 3:30666159-30666181 AATAGTAAACATTTTTAGCCTGG - Intronic
952914954 3:38229311-38229333 TCTATCTAACATTTTTAGCAAGG - Intronic
962473236 3:135732083-135732105 TCTAGCAAGCATTGCCAGCCTGG + Intergenic
967103799 3:186239093-186239115 TCTAACAAGAATTCTTAACCTGG - Intronic
967631860 3:191753210-191753232 GCTAGCAAACAAGCTCAGCCAGG + Intergenic
967662829 3:192134130-192134152 GCTAAGAGACATTCTTAGCCAGG + Intergenic
971939417 4:33195875-33195897 TCTTCCAAACATTCTTATTCTGG + Intergenic
972092293 4:35302412-35302434 TCTAAAAAACATTCTCGGCCGGG + Intergenic
972556990 4:40191685-40191707 TCTAGCAAACATTCACATCCTGG - Intronic
974293232 4:59961567-59961589 ACTTGCAAACACTCTTACCCAGG - Intergenic
975938035 4:79605555-79605577 TCTACTAAAAATACTTAGCCGGG - Intergenic
979375783 4:119944932-119944954 TCTAATACACATTCTTAGGCTGG + Intergenic
980434155 4:132747427-132747449 TCTAGTAAACATTATTTTCCTGG + Intergenic
982623729 4:157737817-157737839 TTTAAAAAACATTTTTAGCCAGG + Intergenic
982922919 4:161299072-161299094 TATAACAAAAATTCTTGGCCAGG + Intergenic
988675297 5:33427357-33427379 CCCAGCAAGCATTCTTAACCAGG - Intergenic
992314347 5:75536989-75537011 TCTAGCAAGCATTGTCTGCCTGG + Intronic
993793539 5:92237142-92237164 CCTAGCAATTATTCTTAACCAGG - Intergenic
995419046 5:111942152-111942174 CTTAGCAAACATTGTTAGCCAGG + Intronic
996955300 5:129176240-129176262 ACTGACAAACACTCTTAGCCAGG - Intergenic
999020111 5:148155381-148155403 TATAGCAAAAGTTCTTACCCAGG + Intergenic
999061508 5:148640415-148640437 TCTAGCAAAAATTCTAGGACTGG - Intronic
1000016541 5:157282711-157282733 TCTACCAAACATTGTTAGTAGGG - Intronic
1000721107 5:164708484-164708506 TGTAACAAACTTTCTTAGCTGGG - Intergenic
1000993231 5:167932790-167932812 TGTATAAAACATTCTTAGCTCGG + Intronic
1004133093 6:12939904-12939926 TATAGTAAACATTCTGAGACAGG - Intronic
1007041133 6:38723408-38723430 TCTAGCAGAAAATCTTGGCCTGG + Exonic
1007295681 6:40818991-40819013 TCTAGCTGACATTCTTGGCATGG + Intergenic
1009946335 6:70346196-70346218 TCCAGCAAGCATTCTTAACTAGG - Intergenic
1010301053 6:74260113-74260135 TCTTGGAAACATTCTTTGGCAGG + Intergenic
1011063281 6:83295391-83295413 TCCAGCAAGGATTCTTAACCAGG + Intronic
1014132161 6:117846721-117846743 TCTAGCAGACATGGCTAGCCTGG - Intergenic
1015789325 6:136950676-136950698 GCATGCAAACATTCTGAGCCTGG - Intergenic
1017466315 6:154697026-154697048 TCTACAAAAAATACTTAGCCAGG + Intergenic
1020589123 7:10112700-10112722 ACTAGAAAACATTTTTAGACAGG - Intergenic
1021264232 7:18499375-18499397 TCTACCAAACATGTTTAGCCTGG - Intronic
1021409703 7:20316052-20316074 TATAACAAAAATCCTTAGCCTGG - Intergenic
1026123284 7:67556468-67556490 TTTAGAAAATATTCATAGCCTGG - Intergenic
1027220530 7:76211105-76211127 TCTAAAAAACATTCTTGGCTGGG - Intronic
1027780253 7:82511439-82511461 TCTAGCAAAGATTTTCAGACTGG - Intergenic
1027975276 7:85146257-85146279 ACTAGTAAAAATCCTTAGCCAGG + Intronic
1029807408 7:103011170-103011192 CCTAGCAATGATTCTTAACCAGG + Intronic
1030620065 7:111779556-111779578 TCTACTAAAAATTCTTAGCTGGG - Intronic
1033952035 7:146796839-146796861 TTAAGAAAACATTCTTGGCCGGG + Intronic
1036181815 8:6592310-6592332 TCTACCAAAAATAATTAGCCGGG - Intronic
1036581458 8:10079318-10079340 TCTACAAAAAATACTTAGCCAGG - Intronic
1037439067 8:18895561-18895583 TCTAGCAAACTTGCTTAGAGTGG - Intronic
1037677267 8:21062008-21062030 TCTTGCAAACATTTGCAGCCAGG + Intergenic
1040020242 8:42734712-42734734 TCTAAAAAAAATTCTTGGCCAGG - Intronic
1040944087 8:52864051-52864073 TCTAGCAATGGTTCTTAACCAGG - Intergenic
1042435211 8:68756198-68756220 TCAAGCACACATTCTGTGCCAGG - Intronic
1042764632 8:72307987-72308009 CCTAGCAATGATTCTTAACCAGG - Intergenic
1043131756 8:76471724-76471746 CCTAGCAATGATTCTTAACCAGG - Intergenic
1043445589 8:80316341-80316363 TCTAGGAAACAAGCATAGCCTGG + Intergenic
1043641066 8:82451497-82451519 CCCAGCAATCATTCTTAACCAGG - Intergenic
1045397123 8:101772279-101772301 TCTAGCAAATATGTTTATCCTGG + Intronic
1048078680 8:131101359-131101381 CCTGGCAAACATTTCTAGCCTGG + Intergenic
1048609704 8:136009041-136009063 TATAGTAAACTTTCTCAGCCAGG - Intergenic
1054289586 9:63271119-63271141 TCTACTAAAAATACTTAGCCAGG + Intergenic
1056898847 9:90579861-90579883 TCTATCAATCATTTTTAGCTTGG + Intergenic
1058179143 9:101775923-101775945 TCTAGCAAACATGCAAAGACAGG - Intergenic
1059961879 9:119573669-119573691 TTGAGCAAACATTATTTGCCAGG - Intergenic
1060111056 9:120906472-120906494 TCTATTAAAAATTCTTTGCCGGG - Intronic
1186221312 X:7352082-7352104 TTTAGAAAACATTCTTAGAGAGG + Exonic
1186424242 X:9451198-9451220 TCCAGAAAACATTCCTTGCCTGG + Intergenic
1186453171 X:9690149-9690171 TCTAGCAAACTTTCTTTACAGGG + Intronic
1189172615 X:38924437-38924459 TCTGGCAGAAATTCTTAACCAGG + Intergenic
1189275853 X:39785591-39785613 TCATGCAAAATTTCTTAGCCTGG + Intergenic
1190230368 X:48577227-48577249 CCTACCAAACATTCCTAGCTAGG + Intronic
1191160838 X:57328575-57328597 TCAAGCAAGCATTCTTAAGCAGG - Intronic
1192187299 X:68957749-68957771 CCTAGCAAACAATTTTAGCAAGG + Intergenic
1192311107 X:70014559-70014581 TCCAGCAAGAGTTCTTAGCCAGG + Intronic
1192770002 X:74178868-74178890 ATTAGCAAACAATCATAGCCTGG - Intergenic
1193686900 X:84587956-84587978 TCCAACAAGCGTTCTTAGCCAGG + Intergenic
1194365616 X:93010498-93010520 TCCAGCAAGAATTCTTAACCAGG - Intergenic
1196020347 X:110984623-110984645 TCTGGCAAACTTTCTTGGGCAGG + Intronic
1196554626 X:117071670-117071692 TCCAGCAAGCATTCTTAAGCAGG + Intergenic
1200673835 Y:6126748-6126770 TCCAGCAAGAATTCTTAACCAGG - Intergenic
1201384139 Y:13419760-13419782 TCTACCAAAATTACTTAGCCAGG - Intronic