ID: 1138969524

View in Genome Browser
Species Human (GRCh38)
Location 16:62128088-62128110
Sequence AATATTGCCTAGCGATGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138969518_1138969524 -8 Left 1138969518 16:62128073-62128095 CCTCCAAATCCCAAGAATATTGC No data
Right 1138969524 16:62128088-62128110 AATATTGCCTAGCGATGCTGGGG No data
1138969517_1138969524 10 Left 1138969517 16:62128055-62128077 CCTTAAATCTGATATTTGCCTCC No data
Right 1138969524 16:62128088-62128110 AATATTGCCTAGCGATGCTGGGG No data
1138969516_1138969524 14 Left 1138969516 16:62128051-62128073 CCTACCTTAAATCTGATATTTGC No data
Right 1138969524 16:62128088-62128110 AATATTGCCTAGCGATGCTGGGG No data
1138969515_1138969524 20 Left 1138969515 16:62128045-62128067 CCTTAGCCTACCTTAAATCTGAT No data
Right 1138969524 16:62128088-62128110 AATATTGCCTAGCGATGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138969524 Original CRISPR AATATTGCCTAGCGATGCTG GGG Intergenic
No off target data available for this crispr