ID: 1138969651

View in Genome Browser
Species Human (GRCh38)
Location 16:62129427-62129449
Sequence CTGTGTTATTCTGAGCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138969651_1138969657 -9 Left 1138969651 16:62129427-62129449 CCAACCTGCTCAGAATAACACAG No data
Right 1138969657 16:62129441-62129463 ATAACACAGGCAAGGGTTGGAGG No data
1138969651_1138969659 3 Left 1138969651 16:62129427-62129449 CCAACCTGCTCAGAATAACACAG No data
Right 1138969659 16:62129453-62129475 AGGGTTGGAGGAGGTAAAATTGG No data
1138969651_1138969658 -6 Left 1138969651 16:62129427-62129449 CCAACCTGCTCAGAATAACACAG No data
Right 1138969658 16:62129444-62129466 ACACAGGCAAGGGTTGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138969651 Original CRISPR CTGTGTTATTCTGAGCAGGT TGG (reversed) Intergenic
No off target data available for this crispr