ID: 1138973310

View in Genome Browser
Species Human (GRCh38)
Location 16:62172129-62172151
Sequence CAGTGTCTCCCTAAGAAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138973310_1138973314 18 Left 1138973310 16:62172129-62172151 CCAACCTTCTTAGGGAGACACTG No data
Right 1138973314 16:62172170-62172192 CTTATACATGTTCATTTTGGTGG No data
1138973310_1138973313 15 Left 1138973310 16:62172129-62172151 CCAACCTTCTTAGGGAGACACTG No data
Right 1138973313 16:62172167-62172189 CAACTTATACATGTTCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138973310 Original CRISPR CAGTGTCTCCCTAAGAAGGT TGG (reversed) Intergenic
No off target data available for this crispr