ID: 1138973314 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:62172170-62172192 |
Sequence | CTTATACATGTTCATTTTGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1138973310_1138973314 | 18 | Left | 1138973310 | 16:62172129-62172151 | CCAACCTTCTTAGGGAGACACTG | No data | ||
Right | 1138973314 | 16:62172170-62172192 | CTTATACATGTTCATTTTGGTGG | No data | ||||
1138973311_1138973314 | 14 | Left | 1138973311 | 16:62172133-62172155 | CCTTCTTAGGGAGACACTGTGAT | No data | ||
Right | 1138973314 | 16:62172170-62172192 | CTTATACATGTTCATTTTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1138973314 | Original CRISPR | CTTATACATGTTCATTTTGG TGG | Intergenic | ||
No off target data available for this crispr |