ID: 1138973314

View in Genome Browser
Species Human (GRCh38)
Location 16:62172170-62172192
Sequence CTTATACATGTTCATTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138973310_1138973314 18 Left 1138973310 16:62172129-62172151 CCAACCTTCTTAGGGAGACACTG No data
Right 1138973314 16:62172170-62172192 CTTATACATGTTCATTTTGGTGG No data
1138973311_1138973314 14 Left 1138973311 16:62172133-62172155 CCTTCTTAGGGAGACACTGTGAT No data
Right 1138973314 16:62172170-62172192 CTTATACATGTTCATTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138973314 Original CRISPR CTTATACATGTTCATTTTGG TGG Intergenic
No off target data available for this crispr