ID: 1138978512

View in Genome Browser
Species Human (GRCh38)
Location 16:62238314-62238336
Sequence ACCCCCTGACCAATAAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138978512_1138978521 19 Left 1138978512 16:62238314-62238336 CCAGGGTTTATTGGTCAGGGGGT No data
Right 1138978521 16:62238356-62238378 GGAAGGGAGGAGTTATTTGGGGG No data
1138978512_1138978517 6 Left 1138978512 16:62238314-62238336 CCAGGGTTTATTGGTCAGGGGGT No data
Right 1138978517 16:62238343-62238365 TTTATAAAGAAATGGAAGGGAGG No data
1138978512_1138978520 18 Left 1138978512 16:62238314-62238336 CCAGGGTTTATTGGTCAGGGGGT No data
Right 1138978520 16:62238355-62238377 TGGAAGGGAGGAGTTATTTGGGG No data
1138978512_1138978519 17 Left 1138978512 16:62238314-62238336 CCAGGGTTTATTGGTCAGGGGGT No data
Right 1138978519 16:62238354-62238376 ATGGAAGGGAGGAGTTATTTGGG No data
1138978512_1138978518 16 Left 1138978512 16:62238314-62238336 CCAGGGTTTATTGGTCAGGGGGT No data
Right 1138978518 16:62238353-62238375 AATGGAAGGGAGGAGTTATTTGG No data
1138978512_1138978515 2 Left 1138978512 16:62238314-62238336 CCAGGGTTTATTGGTCAGGGGGT No data
Right 1138978515 16:62238339-62238361 CATGTTTATAAAGAAATGGAAGG No data
1138978512_1138978516 3 Left 1138978512 16:62238314-62238336 CCAGGGTTTATTGGTCAGGGGGT No data
Right 1138978516 16:62238340-62238362 ATGTTTATAAAGAAATGGAAGGG No data
1138978512_1138978513 -2 Left 1138978512 16:62238314-62238336 CCAGGGTTTATTGGTCAGGGGGT No data
Right 1138978513 16:62238335-62238357 GTGCCATGTTTATAAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138978512 Original CRISPR ACCCCCTGACCAATAAACCC TGG (reversed) Intergenic
No off target data available for this crispr