ID: 1138979434

View in Genome Browser
Species Human (GRCh38)
Location 16:62249368-62249390
Sequence TGGGTGGGTGATTGGATCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138979434_1138979444 21 Left 1138979434 16:62249368-62249390 CCCATGATCCAATCACCCACCCA No data
Right 1138979444 16:62249412-62249434 GATCCCTCCCTTGACATGTGAGG No data
1138979434_1138979438 -8 Left 1138979434 16:62249368-62249390 CCCATGATCCAATCACCCACCCA No data
Right 1138979438 16:62249383-62249405 CCCACCCACCTCCACAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138979434 Original CRISPR TGGGTGGGTGATTGGATCAT GGG (reversed) Intergenic
No off target data available for this crispr