ID: 1138979437

View in Genome Browser
Species Human (GRCh38)
Location 16:62249383-62249405
Sequence CCTGAATTGTGGAGGTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138979437_1138979450 20 Left 1138979437 16:62249383-62249405 CCCACCCACCTCCACAATTCAGG No data
Right 1138979450 16:62249426-62249448 CATGTGAGGATTACAATTGGAGG No data
1138979437_1138979451 21 Left 1138979437 16:62249383-62249405 CCCACCCACCTCCACAATTCAGG No data
Right 1138979451 16:62249427-62249449 ATGTGAGGATTACAATTGGAGGG No data
1138979437_1138979449 17 Left 1138979437 16:62249383-62249405 CCCACCCACCTCCACAATTCAGG No data
Right 1138979449 16:62249423-62249445 TGACATGTGAGGATTACAATTGG No data
1138979437_1138979452 22 Left 1138979437 16:62249383-62249405 CCCACCCACCTCCACAATTCAGG No data
Right 1138979452 16:62249428-62249450 TGTGAGGATTACAATTGGAGGGG No data
1138979437_1138979444 6 Left 1138979437 16:62249383-62249405 CCCACCCACCTCCACAATTCAGG No data
Right 1138979444 16:62249412-62249434 GATCCCTCCCTTGACATGTGAGG No data
1138979437_1138979453 30 Left 1138979437 16:62249383-62249405 CCCACCCACCTCCACAATTCAGG No data
Right 1138979453 16:62249436-62249458 TTACAATTGGAGGGGAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138979437 Original CRISPR CCTGAATTGTGGAGGTGGGT GGG (reversed) Intergenic