ID: 1138979442

View in Genome Browser
Species Human (GRCh38)
Location 16:62249391-62249413
Sequence TCTGTAATCCTGAATTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138979442_1138979453 22 Left 1138979442 16:62249391-62249413 CCTCCACAATTCAGGATTACAGA No data
Right 1138979453 16:62249436-62249458 TTACAATTGGAGGGGAGATTTGG No data
1138979442_1138979452 14 Left 1138979442 16:62249391-62249413 CCTCCACAATTCAGGATTACAGA No data
Right 1138979452 16:62249428-62249450 TGTGAGGATTACAATTGGAGGGG No data
1138979442_1138979455 27 Left 1138979442 16:62249391-62249413 CCTCCACAATTCAGGATTACAGA No data
Right 1138979455 16:62249441-62249463 ATTGGAGGGGAGATTTGGATGGG No data
1138979442_1138979449 9 Left 1138979442 16:62249391-62249413 CCTCCACAATTCAGGATTACAGA No data
Right 1138979449 16:62249423-62249445 TGACATGTGAGGATTACAATTGG No data
1138979442_1138979454 26 Left 1138979442 16:62249391-62249413 CCTCCACAATTCAGGATTACAGA No data
Right 1138979454 16:62249440-62249462 AATTGGAGGGGAGATTTGGATGG No data
1138979442_1138979456 28 Left 1138979442 16:62249391-62249413 CCTCCACAATTCAGGATTACAGA No data
Right 1138979456 16:62249442-62249464 TTGGAGGGGAGATTTGGATGGGG No data
1138979442_1138979451 13 Left 1138979442 16:62249391-62249413 CCTCCACAATTCAGGATTACAGA No data
Right 1138979451 16:62249427-62249449 ATGTGAGGATTACAATTGGAGGG No data
1138979442_1138979444 -2 Left 1138979442 16:62249391-62249413 CCTCCACAATTCAGGATTACAGA No data
Right 1138979444 16:62249412-62249434 GATCCCTCCCTTGACATGTGAGG No data
1138979442_1138979450 12 Left 1138979442 16:62249391-62249413 CCTCCACAATTCAGGATTACAGA No data
Right 1138979450 16:62249426-62249448 CATGTGAGGATTACAATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138979442 Original CRISPR TCTGTAATCCTGAATTGTGG AGG (reversed) Intergenic
No off target data available for this crispr