ID: 1138979445

View in Genome Browser
Species Human (GRCh38)
Location 16:62249415-62249437
Sequence AATCCTCACATGTCAAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9119
Summary {0: 17, 1: 229, 2: 1350, 3: 2783, 4: 4740}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138979445_1138979455 3 Left 1138979445 16:62249415-62249437 CCCTCCCTTGACATGTGAGGATT 0: 17
1: 229
2: 1350
3: 2783
4: 4740
Right 1138979455 16:62249441-62249463 ATTGGAGGGGAGATTTGGATGGG No data
1138979445_1138979452 -10 Left 1138979445 16:62249415-62249437 CCCTCCCTTGACATGTGAGGATT 0: 17
1: 229
2: 1350
3: 2783
4: 4740
Right 1138979452 16:62249428-62249450 TGTGAGGATTACAATTGGAGGGG No data
1138979445_1138979453 -2 Left 1138979445 16:62249415-62249437 CCCTCCCTTGACATGTGAGGATT 0: 17
1: 229
2: 1350
3: 2783
4: 4740
Right 1138979453 16:62249436-62249458 TTACAATTGGAGGGGAGATTTGG No data
1138979445_1138979456 4 Left 1138979445 16:62249415-62249437 CCCTCCCTTGACATGTGAGGATT 0: 17
1: 229
2: 1350
3: 2783
4: 4740
Right 1138979456 16:62249442-62249464 TTGGAGGGGAGATTTGGATGGGG No data
1138979445_1138979454 2 Left 1138979445 16:62249415-62249437 CCCTCCCTTGACATGTGAGGATT 0: 17
1: 229
2: 1350
3: 2783
4: 4740
Right 1138979454 16:62249440-62249462 AATTGGAGGGGAGATTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138979445 Original CRISPR AATCCTCACATGTCAAGGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr