ID: 1138979446

View in Genome Browser
Species Human (GRCh38)
Location 16:62249416-62249438
Sequence TAATCCTCACATGTCAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8980
Summary {0: 23, 1: 415, 2: 1400, 3: 2865, 4: 4277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138979446_1138979456 3 Left 1138979446 16:62249416-62249438 CCTCCCTTGACATGTGAGGATTA 0: 23
1: 415
2: 1400
3: 2865
4: 4277
Right 1138979456 16:62249442-62249464 TTGGAGGGGAGATTTGGATGGGG No data
1138979446_1138979454 1 Left 1138979446 16:62249416-62249438 CCTCCCTTGACATGTGAGGATTA 0: 23
1: 415
2: 1400
3: 2865
4: 4277
Right 1138979454 16:62249440-62249462 AATTGGAGGGGAGATTTGGATGG No data
1138979446_1138979453 -3 Left 1138979446 16:62249416-62249438 CCTCCCTTGACATGTGAGGATTA 0: 23
1: 415
2: 1400
3: 2865
4: 4277
Right 1138979453 16:62249436-62249458 TTACAATTGGAGGGGAGATTTGG No data
1138979446_1138979455 2 Left 1138979446 16:62249416-62249438 CCTCCCTTGACATGTGAGGATTA 0: 23
1: 415
2: 1400
3: 2865
4: 4277
Right 1138979455 16:62249441-62249463 ATTGGAGGGGAGATTTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138979446 Original CRISPR TAATCCTCACATGTCAAGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr