ID: 1138979447

View in Genome Browser
Species Human (GRCh38)
Location 16:62249419-62249441
Sequence TTGTAATCCTCACATGTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4767
Summary {0: 17, 1: 162, 2: 547, 3: 1465, 4: 2576}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138979447_1138979453 -6 Left 1138979447 16:62249419-62249441 CCCTTGACATGTGAGGATTACAA 0: 17
1: 162
2: 547
3: 1465
4: 2576
Right 1138979453 16:62249436-62249458 TTACAATTGGAGGGGAGATTTGG No data
1138979447_1138979454 -2 Left 1138979447 16:62249419-62249441 CCCTTGACATGTGAGGATTACAA 0: 17
1: 162
2: 547
3: 1465
4: 2576
Right 1138979454 16:62249440-62249462 AATTGGAGGGGAGATTTGGATGG No data
1138979447_1138979455 -1 Left 1138979447 16:62249419-62249441 CCCTTGACATGTGAGGATTACAA 0: 17
1: 162
2: 547
3: 1465
4: 2576
Right 1138979455 16:62249441-62249463 ATTGGAGGGGAGATTTGGATGGG No data
1138979447_1138979456 0 Left 1138979447 16:62249419-62249441 CCCTTGACATGTGAGGATTACAA 0: 17
1: 162
2: 547
3: 1465
4: 2576
Right 1138979456 16:62249442-62249464 TTGGAGGGGAGATTTGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138979447 Original CRISPR TTGTAATCCTCACATGTCAA GGG (reversed) Intergenic
Too many off-targets to display for this crispr