ID: 1138979448

View in Genome Browser
Species Human (GRCh38)
Location 16:62249420-62249442
Sequence ATTGTAATCCTCACATGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4046
Summary {0: 22, 1: 219, 2: 570, 3: 1188, 4: 2047}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138979448_1138979454 -3 Left 1138979448 16:62249420-62249442 CCTTGACATGTGAGGATTACAAT 0: 22
1: 219
2: 570
3: 1188
4: 2047
Right 1138979454 16:62249440-62249462 AATTGGAGGGGAGATTTGGATGG No data
1138979448_1138979456 -1 Left 1138979448 16:62249420-62249442 CCTTGACATGTGAGGATTACAAT 0: 22
1: 219
2: 570
3: 1188
4: 2047
Right 1138979456 16:62249442-62249464 TTGGAGGGGAGATTTGGATGGGG No data
1138979448_1138979455 -2 Left 1138979448 16:62249420-62249442 CCTTGACATGTGAGGATTACAAT 0: 22
1: 219
2: 570
3: 1188
4: 2047
Right 1138979455 16:62249441-62249463 ATTGGAGGGGAGATTTGGATGGG No data
1138979448_1138979453 -7 Left 1138979448 16:62249420-62249442 CCTTGACATGTGAGGATTACAAT 0: 22
1: 219
2: 570
3: 1188
4: 2047
Right 1138979453 16:62249436-62249458 TTACAATTGGAGGGGAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138979448 Original CRISPR ATTGTAATCCTCACATGTCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr