ID: 1138979449

View in Genome Browser
Species Human (GRCh38)
Location 16:62249423-62249445
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138979442_1138979449 9 Left 1138979442 16:62249391-62249413 CCTCCACAATTCAGGATTACAGA No data
Right 1138979449 16:62249423-62249445 TGACATGTGAGGATTACAATTGG No data
1138979437_1138979449 17 Left 1138979437 16:62249383-62249405 CCCACCCACCTCCACAATTCAGG No data
Right 1138979449 16:62249423-62249445 TGACATGTGAGGATTACAATTGG No data
1138979441_1138979449 12 Left 1138979441 16:62249388-62249410 CCACCTCCACAATTCAGGATTAC No data
Right 1138979449 16:62249423-62249445 TGACATGTGAGGATTACAATTGG No data
1138979443_1138979449 6 Left 1138979443 16:62249394-62249416 CCACAATTCAGGATTACAGATCC No data
Right 1138979449 16:62249423-62249445 TGACATGTGAGGATTACAATTGG No data
1138979440_1138979449 13 Left 1138979440 16:62249387-62249409 CCCACCTCCACAATTCAGGATTA No data
Right 1138979449 16:62249423-62249445 TGACATGTGAGGATTACAATTGG No data
1138979436_1138979449 24 Left 1138979436 16:62249376-62249398 CCAATCACCCACCCACCTCCACA No data
Right 1138979449 16:62249423-62249445 TGACATGTGAGGATTACAATTGG No data
1138979439_1138979449 16 Left 1138979439 16:62249384-62249406 CCACCCACCTCCACAATTCAGGA No data
Right 1138979449 16:62249423-62249445 TGACATGTGAGGATTACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138979449 Original CRISPR TGACATGTGAGGATTACAAT TGG Intergenic
No off target data available for this crispr