ID: 1138979456

View in Genome Browser
Species Human (GRCh38)
Location 16:62249442-62249464
Sequence TTGGAGGGGAGATTTGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138979447_1138979456 0 Left 1138979447 16:62249419-62249441 CCCTTGACATGTGAGGATTACAA 0: 17
1: 162
2: 547
3: 1465
4: 2576
Right 1138979456 16:62249442-62249464 TTGGAGGGGAGATTTGGATGGGG No data
1138979445_1138979456 4 Left 1138979445 16:62249415-62249437 CCCTCCCTTGACATGTGAGGATT 0: 17
1: 229
2: 1350
3: 2783
4: 4740
Right 1138979456 16:62249442-62249464 TTGGAGGGGAGATTTGGATGGGG No data
1138979443_1138979456 25 Left 1138979443 16:62249394-62249416 CCACAATTCAGGATTACAGATCC No data
Right 1138979456 16:62249442-62249464 TTGGAGGGGAGATTTGGATGGGG No data
1138979446_1138979456 3 Left 1138979446 16:62249416-62249438 CCTCCCTTGACATGTGAGGATTA 0: 23
1: 415
2: 1400
3: 2865
4: 4277
Right 1138979456 16:62249442-62249464 TTGGAGGGGAGATTTGGATGGGG No data
1138979448_1138979456 -1 Left 1138979448 16:62249420-62249442 CCTTGACATGTGAGGATTACAAT 0: 22
1: 219
2: 570
3: 1188
4: 2047
Right 1138979456 16:62249442-62249464 TTGGAGGGGAGATTTGGATGGGG No data
1138979442_1138979456 28 Left 1138979442 16:62249391-62249413 CCTCCACAATTCAGGATTACAGA No data
Right 1138979456 16:62249442-62249464 TTGGAGGGGAGATTTGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138979456 Original CRISPR TTGGAGGGGAGATTTGGATG GGG Intergenic
No off target data available for this crispr