ID: 1138984696

View in Genome Browser
Species Human (GRCh38)
Location 16:62314260-62314282
Sequence AGGTTTACAGAGATGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138984688_1138984696 21 Left 1138984688 16:62314216-62314238 CCTCACAACGGGATAATGAAAGA No data
Right 1138984696 16:62314260-62314282 AGGTTTACAGAGATGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138984696 Original CRISPR AGGTTTACAGAGATGGAGCC AGG Intergenic
No off target data available for this crispr