ID: 1138986780

View in Genome Browser
Species Human (GRCh38)
Location 16:62338588-62338610
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138986780_1138986782 -7 Left 1138986780 16:62338588-62338610 CCCTACACATTCTACTTATGAAG No data
Right 1138986782 16:62338604-62338626 TATGAAGTGACAGTCTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138986780 Original CRISPR CTTCATAAGTAGAATGTGTA GGG (reversed) Intergenic
No off target data available for this crispr