ID: 1138988855

View in Genome Browser
Species Human (GRCh38)
Location 16:62365655-62365677
Sequence CATTCCCAGCAGAAGTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138988854_1138988855 -1 Left 1138988854 16:62365633-62365655 CCATAATGACTATGCTAATTTAC No data
Right 1138988855 16:62365655-62365677 CATTCCCAGCAGAAGTTGTCTGG No data
1138988853_1138988855 11 Left 1138988853 16:62365621-62365643 CCATACTGTTTTCCATAATGACT 0: 58
1: 538
2: 1502
3: 3636
4: 9080
Right 1138988855 16:62365655-62365677 CATTCCCAGCAGAAGTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138988855 Original CRISPR CATTCCCAGCAGAAGTTGTC TGG Intergenic
No off target data available for this crispr