ID: 1138988855 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:62365655-62365677 |
Sequence | CATTCCCAGCAGAAGTTGTC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1138988854_1138988855 | -1 | Left | 1138988854 | 16:62365633-62365655 | CCATAATGACTATGCTAATTTAC | No data | ||
Right | 1138988855 | 16:62365655-62365677 | CATTCCCAGCAGAAGTTGTCTGG | No data | ||||
1138988853_1138988855 | 11 | Left | 1138988853 | 16:62365621-62365643 | CCATACTGTTTTCCATAATGACT | 0: 58 1: 538 2: 1502 3: 3636 4: 9080 |
||
Right | 1138988855 | 16:62365655-62365677 | CATTCCCAGCAGAAGTTGTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1138988855 | Original CRISPR | CATTCCCAGCAGAAGTTGTC TGG | Intergenic | ||
No off target data available for this crispr |