ID: 1138998869

View in Genome Browser
Species Human (GRCh38)
Location 16:62484573-62484595
Sequence TCTAGTAATTCCCCTTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138998866_1138998869 24 Left 1138998866 16:62484526-62484548 CCAGGTTGTCAACTATACTTTTG No data
Right 1138998869 16:62484573-62484595 TCTAGTAATTCCCCTTCTCCAGG No data
1138998865_1138998869 25 Left 1138998865 16:62484525-62484547 CCCAGGTTGTCAACTATACTTTT No data
Right 1138998869 16:62484573-62484595 TCTAGTAATTCCCCTTCTCCAGG No data
1138998868_1138998869 0 Left 1138998868 16:62484550-62484572 CCAAATTGCTACAAATTGGCAAT No data
Right 1138998869 16:62484573-62484595 TCTAGTAATTCCCCTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138998869 Original CRISPR TCTAGTAATTCCCCTTCTCC AGG Intergenic
No off target data available for this crispr