ID: 1139006012

View in Genome Browser
Species Human (GRCh38)
Location 16:62572448-62572470
Sequence CTGGAAAAGGATGGCTCCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139006012_1139006018 12 Left 1139006012 16:62572448-62572470 CCGAAGGAGCCATCCTTTTCCAG No data
Right 1139006018 16:62572483-62572505 ATGCCACACAGAGCTCAGATGGG No data
1139006012_1139006022 26 Left 1139006012 16:62572448-62572470 CCGAAGGAGCCATCCTTTTCCAG No data
Right 1139006022 16:62572497-62572519 TCAGATGGGTGGACAGATTTGGG No data
1139006012_1139006021 25 Left 1139006012 16:62572448-62572470 CCGAAGGAGCCATCCTTTTCCAG No data
Right 1139006021 16:62572496-62572518 CTCAGATGGGTGGACAGATTTGG No data
1139006012_1139006020 15 Left 1139006012 16:62572448-62572470 CCGAAGGAGCCATCCTTTTCCAG No data
Right 1139006020 16:62572486-62572508 CCACACAGAGCTCAGATGGGTGG No data
1139006012_1139006023 30 Left 1139006012 16:62572448-62572470 CCGAAGGAGCCATCCTTTTCCAG No data
Right 1139006023 16:62572501-62572523 ATGGGTGGACAGATTTGGGAAGG No data
1139006012_1139006017 11 Left 1139006012 16:62572448-62572470 CCGAAGGAGCCATCCTTTTCCAG No data
Right 1139006017 16:62572482-62572504 TATGCCACACAGAGCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139006012 Original CRISPR CTGGAAAAGGATGGCTCCTT CGG (reversed) Intergenic
No off target data available for this crispr