ID: 1139006017

View in Genome Browser
Species Human (GRCh38)
Location 16:62572482-62572504
Sequence TATGCCACACAGAGCTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139006014_1139006017 -2 Left 1139006014 16:62572461-62572483 CCTTTTCCAGCAGTCCAGATCTA No data
Right 1139006017 16:62572482-62572504 TATGCCACACAGAGCTCAGATGG No data
1139006012_1139006017 11 Left 1139006012 16:62572448-62572470 CCGAAGGAGCCATCCTTTTCCAG No data
Right 1139006017 16:62572482-62572504 TATGCCACACAGAGCTCAGATGG No data
1139006011_1139006017 15 Left 1139006011 16:62572444-62572466 CCTGCCGAAGGAGCCATCCTTTT No data
Right 1139006017 16:62572482-62572504 TATGCCACACAGAGCTCAGATGG No data
1139006015_1139006017 -8 Left 1139006015 16:62572467-62572489 CCAGCAGTCCAGATCTATGCCAC No data
Right 1139006017 16:62572482-62572504 TATGCCACACAGAGCTCAGATGG No data
1139006013_1139006017 2 Left 1139006013 16:62572457-62572479 CCATCCTTTTCCAGCAGTCCAGA No data
Right 1139006017 16:62572482-62572504 TATGCCACACAGAGCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139006017 Original CRISPR TATGCCACACAGAGCTCAGA TGG Intergenic
No off target data available for this crispr