ID: 1139006022

View in Genome Browser
Species Human (GRCh38)
Location 16:62572497-62572519
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139006015_1139006022 7 Left 1139006015 16:62572467-62572489 CCAGCAGTCCAGATCTATGCCAC No data
Right 1139006022 16:62572497-62572519 TCAGATGGGTGGACAGATTTGGG No data
1139006016_1139006022 -1 Left 1139006016 16:62572475-62572497 CCAGATCTATGCCACACAGAGCT No data
Right 1139006022 16:62572497-62572519 TCAGATGGGTGGACAGATTTGGG No data
1139006011_1139006022 30 Left 1139006011 16:62572444-62572466 CCTGCCGAAGGAGCCATCCTTTT No data
Right 1139006022 16:62572497-62572519 TCAGATGGGTGGACAGATTTGGG No data
1139006013_1139006022 17 Left 1139006013 16:62572457-62572479 CCATCCTTTTCCAGCAGTCCAGA No data
Right 1139006022 16:62572497-62572519 TCAGATGGGTGGACAGATTTGGG No data
1139006014_1139006022 13 Left 1139006014 16:62572461-62572483 CCTTTTCCAGCAGTCCAGATCTA No data
Right 1139006022 16:62572497-62572519 TCAGATGGGTGGACAGATTTGGG No data
1139006012_1139006022 26 Left 1139006012 16:62572448-62572470 CCGAAGGAGCCATCCTTTTCCAG No data
Right 1139006022 16:62572497-62572519 TCAGATGGGTGGACAGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139006022 Original CRISPR TCAGATGGGTGGACAGATTT GGG Intergenic
No off target data available for this crispr