ID: 1139016218

View in Genome Browser
Species Human (GRCh38)
Location 16:62692192-62692214
Sequence CTACCATGGTGGCACTAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139016218_1139016224 6 Left 1139016218 16:62692192-62692214 CCCCTCTAGTGCCACCATGGTAG No data
Right 1139016224 16:62692221-62692243 CCCTGCTACCCTAGACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139016218 Original CRISPR CTACCATGGTGGCACTAGAG GGG (reversed) Intergenic
No off target data available for this crispr