ID: 1139016224

View in Genome Browser
Species Human (GRCh38)
Location 16:62692221-62692243
Sequence CCCTGCTACCCTAGACAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139016220_1139016224 4 Left 1139016220 16:62692194-62692216 CCTCTAGTGCCACCATGGTAGCA No data
Right 1139016224 16:62692221-62692243 CCCTGCTACCCTAGACAGTGAGG No data
1139016221_1139016224 -5 Left 1139016221 16:62692203-62692225 CCACCATGGTAGCACAGACCCTG No data
Right 1139016224 16:62692221-62692243 CCCTGCTACCCTAGACAGTGAGG No data
1139016222_1139016224 -8 Left 1139016222 16:62692206-62692228 CCATGGTAGCACAGACCCTGCTA No data
Right 1139016224 16:62692221-62692243 CCCTGCTACCCTAGACAGTGAGG No data
1139016218_1139016224 6 Left 1139016218 16:62692192-62692214 CCCCTCTAGTGCCACCATGGTAG No data
Right 1139016224 16:62692221-62692243 CCCTGCTACCCTAGACAGTGAGG No data
1139016215_1139016224 10 Left 1139016215 16:62692188-62692210 CCACCCCCTCTAGTGCCACCATG No data
Right 1139016224 16:62692221-62692243 CCCTGCTACCCTAGACAGTGAGG No data
1139016219_1139016224 5 Left 1139016219 16:62692193-62692215 CCCTCTAGTGCCACCATGGTAGC No data
Right 1139016224 16:62692221-62692243 CCCTGCTACCCTAGACAGTGAGG No data
1139016217_1139016224 7 Left 1139016217 16:62692191-62692213 CCCCCTCTAGTGCCACCATGGTA No data
Right 1139016224 16:62692221-62692243 CCCTGCTACCCTAGACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139016224 Original CRISPR CCCTGCTACCCTAGACAGTG AGG Intergenic
No off target data available for this crispr