ID: 1139026133

View in Genome Browser
Species Human (GRCh38)
Location 16:62820469-62820491
Sequence CGGTAAATATTAAAGGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139026128_1139026133 15 Left 1139026128 16:62820431-62820453 CCACTGTTTCATTGTGACTGAAA No data
Right 1139026133 16:62820469-62820491 CGGTAAATATTAAAGGAAGACGG No data
1139026130_1139026133 -8 Left 1139026130 16:62820454-62820476 CCTAATTGACTTCCACGGTAAAT No data
Right 1139026133 16:62820469-62820491 CGGTAAATATTAAAGGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139026133 Original CRISPR CGGTAAATATTAAAGGAAGA CGG Intergenic
No off target data available for this crispr