ID: 1139027828

View in Genome Browser
Species Human (GRCh38)
Location 16:62840711-62840733
Sequence CTGACTATAAGAAGGCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139027828_1139027831 1 Left 1139027828 16:62840711-62840733 CCAGGATGCCTTCTTATAGTCAG No data
Right 1139027831 16:62840735-62840757 CTCACCATTTCTCAGCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139027828 Original CRISPR CTGACTATAAGAAGGCATCC TGG (reversed) Intergenic
No off target data available for this crispr