ID: 1139028403

View in Genome Browser
Species Human (GRCh38)
Location 16:62848381-62848403
Sequence TTTGGGGGATGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139028403_1139028417 27 Left 1139028403 16:62848381-62848403 CCCTCTTCCCTCCATCCCCCAAA No data
Right 1139028417 16:62848431-62848453 TTGGTTTTATAACCTCACCTGGG No data
1139028403_1139028416 26 Left 1139028403 16:62848381-62848403 CCCTCTTCCCTCCATCCCCCAAA No data
Right 1139028416 16:62848430-62848452 TTTGGTTTTATAACCTCACCTGG No data
1139028403_1139028413 8 Left 1139028403 16:62848381-62848403 CCCTCTTCCCTCCATCCCCCAAA No data
Right 1139028413 16:62848412-62848434 TAGTCCAGCTCACCAGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139028403 Original CRISPR TTTGGGGGATGGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr