ID: 1139029137

View in Genome Browser
Species Human (GRCh38)
Location 16:62858202-62858224
Sequence GCTTATAAGCAGCTCTTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139029135_1139029137 29 Left 1139029135 16:62858150-62858172 CCATTTTGAATGGTAACAGACTG No data
Right 1139029137 16:62858202-62858224 GCTTATAAGCAGCTCTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139029137 Original CRISPR GCTTATAAGCAGCTCTTACA TGG Intergenic
No off target data available for this crispr