ID: 1139030487

View in Genome Browser
Species Human (GRCh38)
Location 16:62875221-62875243
Sequence TAGATACACCAGGAAGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139030487_1139030492 30 Left 1139030487 16:62875221-62875243 CCTGTGCCTTCCTGGTGTATCTA No data
Right 1139030492 16:62875274-62875296 GAAGCTAGTCAGATTGGATTAGG No data
1139030487_1139030490 8 Left 1139030487 16:62875221-62875243 CCTGTGCCTTCCTGGTGTATCTA No data
Right 1139030490 16:62875252-62875274 TCTAAGATCATCTTCTGAAAAGG No data
1139030487_1139030491 24 Left 1139030487 16:62875221-62875243 CCTGTGCCTTCCTGGTGTATCTA No data
Right 1139030491 16:62875268-62875290 GAAAAGGAAGCTAGTCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139030487 Original CRISPR TAGATACACCAGGAAGGCAC AGG (reversed) Intergenic
No off target data available for this crispr