ID: 1139030489

View in Genome Browser
Species Human (GRCh38)
Location 16:62875231-62875253
Sequence GAACAACACATAGATACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139030489_1139030492 20 Left 1139030489 16:62875231-62875253 CCTGGTGTATCTATGTGTTGTTC No data
Right 1139030492 16:62875274-62875296 GAAGCTAGTCAGATTGGATTAGG No data
1139030489_1139030490 -2 Left 1139030489 16:62875231-62875253 CCTGGTGTATCTATGTGTTGTTC No data
Right 1139030490 16:62875252-62875274 TCTAAGATCATCTTCTGAAAAGG No data
1139030489_1139030491 14 Left 1139030489 16:62875231-62875253 CCTGGTGTATCTATGTGTTGTTC No data
Right 1139030491 16:62875268-62875290 GAAAAGGAAGCTAGTCAGATTGG No data
1139030489_1139030493 21 Left 1139030489 16:62875231-62875253 CCTGGTGTATCTATGTGTTGTTC No data
Right 1139030493 16:62875275-62875297 AAGCTAGTCAGATTGGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139030489 Original CRISPR GAACAACACATAGATACACC AGG (reversed) Intergenic
No off target data available for this crispr