ID: 1139030492

View in Genome Browser
Species Human (GRCh38)
Location 16:62875274-62875296
Sequence GAAGCTAGTCAGATTGGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139030489_1139030492 20 Left 1139030489 16:62875231-62875253 CCTGGTGTATCTATGTGTTGTTC No data
Right 1139030492 16:62875274-62875296 GAAGCTAGTCAGATTGGATTAGG No data
1139030488_1139030492 24 Left 1139030488 16:62875227-62875249 CCTTCCTGGTGTATCTATGTGTT No data
Right 1139030492 16:62875274-62875296 GAAGCTAGTCAGATTGGATTAGG No data
1139030487_1139030492 30 Left 1139030487 16:62875221-62875243 CCTGTGCCTTCCTGGTGTATCTA No data
Right 1139030492 16:62875274-62875296 GAAGCTAGTCAGATTGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139030492 Original CRISPR GAAGCTAGTCAGATTGGATT AGG Intergenic
No off target data available for this crispr