ID: 1139033483

View in Genome Browser
Species Human (GRCh38)
Location 16:62914280-62914302
Sequence AATTGATTGTAAGAATATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139033483_1139033487 2 Left 1139033483 16:62914280-62914302 CCCCCATATTCTTACAATCAATT No data
Right 1139033487 16:62914305-62914327 ATATCTCACCTTGATTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139033483 Original CRISPR AATTGATTGTAAGAATATGG GGG (reversed) Intergenic
No off target data available for this crispr