ID: 1139042000

View in Genome Browser
Species Human (GRCh38)
Location 16:63009047-63009069
Sequence ATAGAAAAGAAGAATTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139041997_1139042000 4 Left 1139041997 16:63009020-63009042 CCAACCTAATAATATAGGAGAAA No data
Right 1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG No data
1139041998_1139042000 0 Left 1139041998 16:63009024-63009046 CCTAATAATATAGGAGAAAATAA No data
Right 1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139042000 Original CRISPR ATAGAAAAGAAGAATTAGGA AGG Intergenic
No off target data available for this crispr