ID: 1139042033

View in Genome Browser
Species Human (GRCh38)
Location 16:63009525-63009547
Sequence CACCTGTAATCACTAGCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139042033_1139042034 20 Left 1139042033 16:63009525-63009547 CCTCTCGCTAGTGATTACAGGTG No data
Right 1139042034 16:63009568-63009590 ATGATTAGCTGATTTAAATGTGG No data
1139042033_1139042035 21 Left 1139042033 16:63009525-63009547 CCTCTCGCTAGTGATTACAGGTG No data
Right 1139042035 16:63009569-63009591 TGATTAGCTGATTTAAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139042033 Original CRISPR CACCTGTAATCACTAGCGAG AGG (reversed) Intergenic
No off target data available for this crispr