ID: 1139042035

View in Genome Browser
Species Human (GRCh38)
Location 16:63009569-63009591
Sequence TGATTAGCTGATTTAAATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139042030_1139042035 23 Left 1139042030 16:63009523-63009545 CCCCTCTCGCTAGTGATTACAGG No data
Right 1139042035 16:63009569-63009591 TGATTAGCTGATTTAAATGTGGG No data
1139042033_1139042035 21 Left 1139042033 16:63009525-63009547 CCTCTCGCTAGTGATTACAGGTG No data
Right 1139042035 16:63009569-63009591 TGATTAGCTGATTTAAATGTGGG No data
1139042032_1139042035 22 Left 1139042032 16:63009524-63009546 CCCTCTCGCTAGTGATTACAGGT No data
Right 1139042035 16:63009569-63009591 TGATTAGCTGATTTAAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139042035 Original CRISPR TGATTAGCTGATTTAAATGT GGG Intergenic
No off target data available for this crispr