ID: 1139047175

View in Genome Browser
Species Human (GRCh38)
Location 16:63076056-63076078
Sequence GTTCAGCAGCACCACAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139047175_1139047177 4 Left 1139047175 16:63076056-63076078 CCTACACTGTGGTGCTGCTGAAC No data
Right 1139047177 16:63076083-63076105 ACTCTGATGTACATCTACTTTGG No data
1139047175_1139047178 15 Left 1139047175 16:63076056-63076078 CCTACACTGTGGTGCTGCTGAAC No data
Right 1139047178 16:63076094-63076116 CATCTACTTTGGCCAAATTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139047175 Original CRISPR GTTCAGCAGCACCACAGTGT AGG (reversed) Intergenic
No off target data available for this crispr