ID: 1139059875

View in Genome Browser
Species Human (GRCh38)
Location 16:63236936-63236958
Sequence ACCATGAGCCGCTTGGTTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139059875_1139059877 5 Left 1139059875 16:63236936-63236958 CCACGAACCAAGCGGCTCATGGT No data
Right 1139059877 16:63236964-63236986 ATGCGTCTGAATTACACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139059875 Original CRISPR ACCATGAGCCGCTTGGTTCG TGG (reversed) Intergenic
No off target data available for this crispr