ID: 1139065797

View in Genome Browser
Species Human (GRCh38)
Location 16:63312498-63312520
Sequence GGGGATAGGAAGTCAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139065790_1139065797 17 Left 1139065790 16:63312458-63312480 CCTTACAAACTTGGAGGTCTGAT No data
Right 1139065797 16:63312498-63312520 GGGGATAGGAAGTCAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139065797 Original CRISPR GGGGATAGGAAGTCAAAAGC TGG Intergenic
No off target data available for this crispr