ID: 1139066718

View in Genome Browser
Species Human (GRCh38)
Location 16:63324576-63324598
Sequence TAGAATGGTCTACAAAAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139066718_1139066720 -5 Left 1139066718 16:63324576-63324598 CCAATCTTTTGTAGACCATTCTA No data
Right 1139066720 16:63324594-63324616 TTCTACACTTCCCATTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139066718 Original CRISPR TAGAATGGTCTACAAAAGAT TGG (reversed) Intergenic
No off target data available for this crispr