ID: 1139072312

View in Genome Browser
Species Human (GRCh38)
Location 16:63397876-63397898
Sequence CAGTAAATATTAATGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139072312_1139072315 -3 Left 1139072312 16:63397876-63397898 CCTCCCATCATTAATATTTACTG No data
Right 1139072315 16:63397896-63397918 CTGAGCATTTATAGTGTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139072312 Original CRISPR CAGTAAATATTAATGATGGG AGG (reversed) Intergenic
No off target data available for this crispr