ID: 1139072315

View in Genome Browser
Species Human (GRCh38)
Location 16:63397896-63397918
Sequence CTGAGCATTTATAGTGTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139072311_1139072315 18 Left 1139072311 16:63397855-63397877 CCTTATCATCAAGACTCACTGCC No data
Right 1139072315 16:63397896-63397918 CTGAGCATTTATAGTGTACTAGG No data
1139072313_1139072315 -6 Left 1139072313 16:63397879-63397901 CCCATCATTAATATTTACTGAGC No data
Right 1139072315 16:63397896-63397918 CTGAGCATTTATAGTGTACTAGG No data
1139072314_1139072315 -7 Left 1139072314 16:63397880-63397902 CCATCATTAATATTTACTGAGCA No data
Right 1139072315 16:63397896-63397918 CTGAGCATTTATAGTGTACTAGG No data
1139072312_1139072315 -3 Left 1139072312 16:63397876-63397898 CCTCCCATCATTAATATTTACTG No data
Right 1139072315 16:63397896-63397918 CTGAGCATTTATAGTGTACTAGG No data
1139072310_1139072315 19 Left 1139072310 16:63397854-63397876 CCCTTATCATCAAGACTCACTGC No data
Right 1139072315 16:63397896-63397918 CTGAGCATTTATAGTGTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139072315 Original CRISPR CTGAGCATTTATAGTGTACT AGG Intergenic
No off target data available for this crispr