ID: 1139072553

View in Genome Browser
Species Human (GRCh38)
Location 16:63401037-63401059
Sequence CAGGGTTAACTAAGAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139072551_1139072553 -7 Left 1139072551 16:63401021-63401043 CCACTTTGATGACTCTCAGGGTT No data
Right 1139072553 16:63401037-63401059 CAGGGTTAACTAAGAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139072553 Original CRISPR CAGGGTTAACTAAGAGTGGA AGG Intergenic
No off target data available for this crispr