ID: 1139073601

View in Genome Browser
Species Human (GRCh38)
Location 16:63415441-63415463
Sequence TTTATCTTGTCACCACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139073601_1139073602 23 Left 1139073601 16:63415441-63415463 CCTGTGTGTGGTGACAAGATAAA No data
Right 1139073602 16:63415487-63415509 TTGTCTCCATAATCCAGTTCAGG No data
1139073601_1139073604 30 Left 1139073601 16:63415441-63415463 CCTGTGTGTGGTGACAAGATAAA No data
Right 1139073604 16:63415494-63415516 CATAATCCAGTTCAGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139073601 Original CRISPR TTTATCTTGTCACCACACAC AGG (reversed) Intergenic
No off target data available for this crispr