ID: 1139076200

View in Genome Browser
Species Human (GRCh38)
Location 16:63451927-63451949
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139076200_1139076204 15 Left 1139076200 16:63451927-63451949 CCAAACCCCAAATGTTTCAAAAT No data
Right 1139076204 16:63451965-63451987 CACCGACATGACGTCACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139076200 Original CRISPR ATTTTGAAACATTTGGGGTT TGG (reversed) Intergenic
No off target data available for this crispr