ID: 1139080402 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:63511658-63511680 |
Sequence | GAAGCTTCAAATGCAGGTAT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1139080402_1139080407 | 25 | Left | 1139080402 | 16:63511658-63511680 | CCTATACCTGCATTTGAAGCTTC | No data | ||
Right | 1139080407 | 16:63511706-63511728 | ATTCCCAAGCCTTCTCTTTCGGG | No data | ||||
1139080402_1139080406 | 24 | Left | 1139080402 | 16:63511658-63511680 | CCTATACCTGCATTTGAAGCTTC | No data | ||
Right | 1139080406 | 16:63511705-63511727 | CATTCCCAAGCCTTCTCTTTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1139080402 | Original CRISPR | GAAGCTTCAAATGCAGGTAT AGG (reversed) | Intergenic | ||