ID: 1139080402

View in Genome Browser
Species Human (GRCh38)
Location 16:63511658-63511680
Sequence GAAGCTTCAAATGCAGGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139080402_1139080407 25 Left 1139080402 16:63511658-63511680 CCTATACCTGCATTTGAAGCTTC No data
Right 1139080407 16:63511706-63511728 ATTCCCAAGCCTTCTCTTTCGGG No data
1139080402_1139080406 24 Left 1139080402 16:63511658-63511680 CCTATACCTGCATTTGAAGCTTC No data
Right 1139080406 16:63511705-63511727 CATTCCCAAGCCTTCTCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139080402 Original CRISPR GAAGCTTCAAATGCAGGTAT AGG (reversed) Intergenic