ID: 1139080404 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:63511683-63511705 |
| Sequence | GAAATGTTCATAGCAGGCTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1139080404_1139080407 | 0 | Left | 1139080404 | 16:63511683-63511705 | CCAAAGCCTGCTATGAACATTTC | No data | ||
| Right | 1139080407 | 16:63511706-63511728 | ATTCCCAAGCCTTCTCTTTCGGG | No data | ||||
| 1139080404_1139080406 | -1 | Left | 1139080404 | 16:63511683-63511705 | CCAAAGCCTGCTATGAACATTTC | No data | ||
| Right | 1139080406 | 16:63511705-63511727 | CATTCCCAAGCCTTCTCTTTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1139080404 | Original CRISPR | GAAATGTTCATAGCAGGCTT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||